After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

Mensch Alkaline Phosphatase / ALPL Gene ORF cDNA clone expression plasmid, C-His tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Human ALPL Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_000478.4
cDNA-Größe:1575bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens alkaline phosphatase, liver/bone/kidney with C terminal His tag.
Synonyme für Gene:HOPS, TNAP, TNSALP, AP-TNAP, FLJ40094, FLJ93059, MGC161443, MGC167935, ALPL
Spezies:Human
Vektor:pCMV3-C-His
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Hintergrund

Alkaline phosphatase (ALPL) is a hydrolase enzyme responsible for removing phosphate groups from many types of molecules, including nucleotides, proteins, and alkaloids. The process of removing the phosphate group is called dephosphorylation. As the name suggests, alkaline phosphatases are most effective in an alkaline environment. It is sometimes used synonymously as basic phosphatase. Alkaline phosphatases (APs) are ubiquitous in many species, from bacteria to human. Four genes encode AP isoenzymes in humans and rodents. Three AP genes are expressed in a tissue-specific manner (i.e., placental, embryonic, and intestinal AP isoenzymes). Expression of the fourth AP gene is nonspecific to a single tissue and is especially abundant in bone, liver, and kidney. This isoenzyme is also called tissue-nonspecific alkaline phosphatase (TNAP). The enzyme tissue non-specific alkaline phosphatase (TNAP) belongs to the ectophosphatase family. TNAP is present in large amounts in bone in which it plays a role in mineralization.

Referenzen
  • Brun-Heath I, et al. (2011) Differential expression of the bone and the liver tissue non-specific alkaline phosphatase isoforms in brain tissues. Cell Tissue Res. 343(3): 521-36.
  • Whyte MP, et al. (1995) Alkaline phosphatase: placental and tissue-non-specific isoenzymes hydrolyze phosphoethanolamine, inorganic pyrophosphate, and pyridoxal 5-phosphate. J Clin Invest. 95: 1440-5.
  • Whyte MP. (1994) Hypophosphatasia and the role of alkaline phosphatase in skeletal mineralization. Endocrinol Rev. 4: 439-61.
  • Weinreb M, et al. (1990) Different pattern of alkaline phosphatase, osteopontin and osteocalcin expression in developing rat bone visualized by in situ hybridization. J Bone Miner Res. 5: 831-42.
  • Size / Price
    Katalog: HG10440-CH
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    Verfügbarkeit2-3 weeks
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    Bilder
        Kürzlich angesehene Artikel
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“