Schnelle Bestellung

Mensch ALK-4 / ACVR1B transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc tag

    DatenblattBewertungenÄhnliche ProdukteProtokolle
    Mensch ACVR1B Produktinformation zum cDNA-Klon
    Gene_bank_ref_id:NM_004302.3
    cDNA-Größe:1518bp
    cDNA-Beschreibung:Full length Clone DNA of Homo sapiens activin A receptor, type I B, transcript variant 1 with C terminal Myc tag.
    Synonyme für Gene:ALK4, SKR2, ACTRIB, ACVRLK4
    Spezies:Human
    Vektor:pCMV3-C-Myc
    Plasmid:
    Restriktionsschnittstelle:
    Tag-Sequenz:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Sequenzbeschreibung:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ACVR1B qPCR primers for gene expression analysis, HP100587 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Mensch ALK-4 / ACVR1B transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc tag on other vectors
    Mensch ALK-4 / ACVR1B transcript variant 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG10583-ACG$245
    Mensch ALK-4 / ACVR1B transcript variant 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG10583-ACR$245
    Mensch ALK-4 / ACVR1B transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10583-CF$215
    Mensch ALK-4 / ACVR1B transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His tagHG10583-CH$215
    Mensch ALK-4 / ACVR1B transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc tagHG10583-CM$215
    Mensch ALK-4 / ACVR1B transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA tagHG10583-CY$215
    Mensch ALK-4 / ACVR1B transcript variant 1 Gene ORF cDNA clone in cloning vectorHG10583-M$75
    Mensch ALK-4 / ACVR1B transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10583-M-F$215
    Mensch ALK-4 / ACVR1B transcript variant 1 Gene ORF cDNA clone expression plasmidHG10583-M-N$215
    Mensch ALK-4 / ACVR1B transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag tagHG10583-NF$215
    Mensch ALK-4 / ACVR1B transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His tagHG10583-NH$215
    Mensch ALK-4 / ACVR1B transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Myc tagHG10583-NM$215
    Mensch ALK-4 / ACVR1B transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA tagHG10583-NY$215
    Mensch ALK-4 / ACVR1B transcript variant 1 Gene ORF cDNA clone expression plasmidHG10583-UT$215
     Erfahren Sie mehr über Expressionsvektoren
    Product nameProduct name
    Hintergrund

    ALK-4 (Activin Receptor-Like Kinase 4) or ACVR1B (Activin A Receptor, type 1B), belongs to the protein kinase superfamily, TKL Ser/Thr protein kinase family, and TGFB receptor subfamily. ALK-4/ACVR1B acts as a transducer of activin or activin like ligands signals. Activin binds to either ACVR2A or ACVR2B and then forms a complex with ACVR1B. The known type II activin receptors include ActRII and ActRIIB, while the main type I activin receptor in mammalian cells is ALK-4 (ActRIB). In the presence of activin, type II and type I receptors form complexes whereby the type II receptors activate ALK-4 through phosphorylation. The activated ALK-4, in turn, transduces signals downstream by phosphorylation of its effectors, such as Smads, to regulate gene expression and affect cellular phenotype. ALK-4/ACVR1B is an important regulator of vertebrate development, with roles in mesoderm induction, primitive streak formation, gastrulation, dorsoanterior patterning, and left-right axis determination.

    Referenzen
  • Chen Y, et al. (2005) Developmental analysis of activin-like kinase receptor-4 (ALK4) expression in Xenopus laevis. 232(2): 393-8.
  • J. Massagu. (1998) TGF- SIGNAL TRANSDUCTION. Annual Review of Biochemistry. 67: 753-91.
  • Size / Price
    Katalog: HG10583-CM
    Listenpreis: 
    Preis:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“