FTS cDNA ORF Clone, Human, N-HA tag

Cat: HG15065-NY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All FTS Reagents

CRO Services

Product recommended


All FTS Reagents

FTS cDNA ORF Clone, Human, N-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
879 bp
Description
Full length Clone DNA of Human AKT interacting protein with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FTS cDNA ORF Clone, Human, N-HA tag Alternative Names

FT1 cDNA ORF Clone, Human;FTS cDNA ORF Clone, Human

FTS Background Information

Full Name
AKT interacting protein

FTS cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FTS cDNA ORF Clone in Cloning Vector, Mouse MG51560-U
FTS cDNA ORF Clone, Mouse, untagged MG51560-UT
FTS Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51560-ACGLN
FTS cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51560-ACG
FTS cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51560-ANG
FTS cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51560-ACR
FTS cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51560-ANR
FTS cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51560-CF
FTS cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51560-NF
FTS cDNA ORF Clone, Mouse, C-His tag MG51560-CH
FTS cDNA ORF Clone, Mouse, N-His tag MG51560-NH
FTS cDNA ORF Clone, Mouse, C-HA tag MG51560-CY
FTS cDNA ORF Clone, Mouse, N-HA tag MG51560-NY
FTS cDNA ORF Clone, Mouse, C-Myc tag MG51560-CM
FTS cDNA ORF Clone, Mouse, N-Myc tag MG51560-NM
FTS qPCR Primer Pairs, Mouse MP201443

FTS cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FTS cDNA ORF Clone in Cloning Vector, Human HG15065-G
FTS cDNA ORF Clone, Human, untagged HG15065-UT
FTS cDNA ORF Clone, Human, C-GFPSpark® tag HG15065-ACG
FTS Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15065-ACGLN
FTS cDNA ORF Clone, Human, N-GFPSpark® tag HG15065-ANG
FTS cDNA ORF Clone, Human, C-OFPSpark® tag HG15065-ACR
FTS cDNA ORF Clone, Human, N-OFPSpark® tag HG15065-ANR
FTS cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15065-CF
FTS cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15065-NF
FTS cDNA ORF Clone, Human, C-His tag HG15065-CH
FTS cDNA ORF Clone, Human, N-His tag HG15065-NH
FTS cDNA ORF Clone, Human, C-HA tag HG15065-CY
FTS cDNA ORF Clone, Human, C-Myc tag HG15065-CM
FTS cDNA ORF Clone, Human, N-Myc tag HG15065-NM
FTS qPCR Primer Pairs, Human HP103693
info info
添加购物车成功! 添加购物车失败!