Schnelle Bestellung

Mensch AKT1S1/PRAS40 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-His tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Mensch AKT1S1 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_001098632.1
cDNA-Größe:771bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens AKT1 substrate 1 (proline-rich), transcript variant 2 with N terminal His tag.
Synonyme für Gene:AKT1S1, Lob, PRAS40, MGC2865
Spezies:Human
Vektor:pCMV3-N-His
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with AKT1S1 qPCR primers for gene expression analysis, HP100175 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Mensch AKT1S1/PRAS40 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-His tag on other vectors
Mensch AKT1S1/PRAS40 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG10092-ACG$225
Mensch AKT1S1/PRAS40 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG10092-ACR$225
Mensch AKT1S1/PRAS40 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG10092-ANG$225
Mensch AKT1S1/PRAS40 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG10092-ANR$225
Mensch AKT1S1/PRAS40 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10092-CF$195
Mensch AKT1S1/PRAS40 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-His tagHG10092-CH$195
Mensch AKT1S1/PRAS40 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Myc tagHG10092-CM$195
Mensch AKT1S1/PRAS40 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-HA tagHG10092-CY$195
Mensch AKT1S1/PRAS40 transcript variant 2 Gene ORF cDNA clone in cloning vectorHG10092-M$75
Mensch AKT1S1/PRAS40 transcript variant 2 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10092-M-F$195
Mensch AKT1S1/PRAS40 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Flag tagHG10092-NF$195
Mensch AKT1S1/PRAS40 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-His tagHG10092-NH$195
Mensch AKT1S1/PRAS40 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-Myc tagHG10092-NM$195
Mensch AKT1S1/PRAS40 transcript variant 2 Gene ORF cDNA clone expression plasmid, N-HA tagHG10092-NY$195
Mensch AKT1S1/PRAS40 transcript variant 2 Gene ORF cDNA clone expression plasmidHG10092-UT$195
 Erfahren Sie mehr über Expressionsvektoren
Product nameProduct name
Size / Price
Katalog: HG10092-NH
Listenpreis: 
Preis:      (You Save: )
Contact Us
Bilder
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“