After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Mensch IBA1/AIF1 Gene ORF cDNA clone expression plasmid

DatenblattBewertungenÄhnliche ProdukteProtokolle
Human AIF1 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:BC009474
cDNA-Größe:444bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens allograft inflammatory factor 1.
Synonyme für Gene:DADB-70P7.8, AIF-1, IBA1, IRT-1, IRT1, AIF1
Spezies:Human
Vektor:pCMV3-untagged
Plasmid:pCMV3-AIF1
Restriktionsschnittstelle:KpnI + XbaI (6.1kb + 0.44kb)
Tag-Sequenz:
Sequenzbeschreibung:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Human AIF1 Gene Plasmid Map
Human AIF1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Hintergrund

AIF1, also known as IBA1, is an actin-binding protein. AIF1 is expressed selectively in human macrophage-like cell lines, and in a subset of CD68(+) macrophages in the interstitial and perivascular spaces of human heart allografts. It is expressed in macrophages and neutrophils. AIF1 enhances membrane ruffling and RAC activation. AIF1 enhances the actin-bundling activity of LCP1. It also enhances lymphocyte migration. AIF1 may play a role in macrophage activation and function. It binds calcium and plays a role in RAC signaling and in phagocytosis. It promotes the proliferation of vascular smooth muscle cells and of T-lymphocytes.

Size / Price
Katalog: HG14227-UT
Listenpreis: 
Preis:      (You Save: )
Größe:
Menge:+-
VerfügbarkeitIn Stock
Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
Contact Us
Bilder
  • Human AIF1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Kürzlich angesehene Artikel
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“