After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Mensch Aryl Hydrocarbon Receptor Gene ORF cDNA clone expression plasmid, C-His tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Human AHR Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_001621.3
cDNA-Größe:2547bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens aryl hydrocarbon receptor with C terminal His tag.
Synonyme für Gene:AHR
Spezies:Human
Vektor:pCMV3-C-His
Plasmid:pCMV3-AHR-His
Restriktionsschnittstelle:KpnI + NotI (6kb + 2.59kb)
Tag-Sequenz:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequenzbeschreibung:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Human AHR Gene Plasmid Map
Human AHR ORF mammalian expression plasmid, C-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Size / Price
Katalog: HG10456-CH
Listenpreis: 
Preis:      (You Save: )
Größe:
Menge:+-
VerfügbarkeitIn Stock
Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
Contact Us
Bilder
  • Human AHR ORF mammalian expression plasmid, C-His tag
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“