Schnelle Bestellung

Mensch AHNAK2/AHNAK nucleoprotein 2 Gene ORF cDNA clone expression plasmid

    DatenblattBewertungenÄhnliche ProdukteProtokolle
    Mensch AHNAK2 Produktinformation zum cDNA-Klon
    Gene_bank_ref_id:BC049216
    cDNA-Größe:1452bp
    cDNA-Beschreibung:Full length Clone DNA of Homo sapiens AHNAK nucleoprotein 2 DNA.
    Synonyme für Gene:C14orf78
    Spezies:Human
    Vektor:pCMV3-untagged
    Plasmid:
    Restriktionsschnittstelle:
    Tag-Sequenz:
    Sequenzbeschreibung:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with AHNAK2 qPCR primers for gene expression analysis, HP103846 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
    Mensch AHNAK2/AHNAK nucleoprotein 2 Gene ORF cDNA clone expression plasmid on other vectors
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“