Arp8 cDNA ORF Clone, Human, C-HA tag

Cat: HG14035-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Arp8 Reagents
CRO Services
Product recommended

All Arp8 Reagents
Arp8 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
990 bp
Description
Full length Clone DNA of Human ARP8 actin-related protein 8 homolog (yeast) with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Arp8 cDNA ORF Clone, Human, C-HA tag Alternative Names
ARP8 cDNA ORF Clone, Human;hArp8 cDNA ORF Clone, Human;INO80N cDNA ORF Clone, Human
Arp8 Background Information
Full Name
ARP8 actin-related protein 8 homolog (yeast)

Arp8 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Arp8 cDNA ORF Clone in Cloning Vector, Mouse MG52737-G
Arp8 cDNA ORF Clone, Mouse, untagged MG52737-UT
Arp8 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52737-ACG
Arp8 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52737-ACGLN
Arp8 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52737-ANG
Arp8 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52737-ACR
Arp8 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52737-ANR
Arp8 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52737-CF
Arp8 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52737-NF
Arp8 cDNA ORF Clone, Mouse, C-His tag MG52737-CH
Arp8 cDNA ORF Clone, Mouse, N-His tag MG52737-NH
Arp8 cDNA ORF Clone, Mouse, C-HA tag MG52737-CY
Arp8 cDNA ORF Clone, Mouse, N-HA tag MG52737-NY
Arp8 cDNA ORF Clone, Mouse, C-Myc tag MG52737-CM
Arp8 cDNA ORF Clone, Mouse, N-Myc tag MG52737-NM
Arp8 qPCR Primer Pairs, Mouse MP202608

Arp8 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Arp8 cDNA ORF Clone in Cloning Vector, Human HG14035-G
Arp8 cDNA ORF Clone, Human, untagged HG14035-UT
Arp8 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14035-ACGLN
Arp8 cDNA ORF Clone, Human, C-GFPSpark® tag HG14035-ACG
Arp8 cDNA ORF Clone, Human, N-GFPSpark® tag HG14035-ANG
Arp8 cDNA ORF Clone, Human, C-OFPSpark® tag HG14035-ACR
Arp8 cDNA ORF Clone, Human, N-OFPSpark® tag HG14035-ANR
Arp8 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14035-CF
Arp8 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14035-NF
Arp8 cDNA ORF Clone, Human, C-His tag HG14035-CH
Arp8 cDNA ORF Clone, Human, N-His tag HG14035-NH
Arp8 cDNA ORF Clone, Human, N-HA tag HG14035-NY
Arp8 cDNA ORF Clone, Human, C-Myc tag HG14035-CM
Arp8 cDNA ORF Clone, Human, N-Myc tag HG14035-NM
Arp8 qPCR Primer Pairs, Human HP102691
info info
添加购物车成功! 添加购物车失败!