beta-Actin cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10962-CF

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All beta-Actin Reagents

CRO Services

Product recommended


All beta-Actin Reagents

beta-Actin cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1128 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human actin, beta with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI (6kb + 1.18kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

beta-Actin cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

beta-Actin cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images

other Green fluorescent protein / GFP Gene Plasmid Map 5609

beta-Actin cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names

BRWS1 cDNA ORF Clone, Human;PS1TP5BP1 cDNA ORF Clone, Human

beta-Actin Background Information

ACTB (Actin Beta) is a Protein Coding gene. Diseases associated with ACTB include Dystonia, Juvenile-Onset and Baraitser-Winter Syndrome 1. Among its related pathways are Salivary secretion and Development Slit-Robo signaling. Gene Ontology (GO) annotations related to this gene include identical protein binding and RNA polymerase II proximal promoter sequence-specific DNA binding. An important paralog of this gene is ACTG1. TUBB, HPRT and ACTB were the most stably expressed genes for all analysis groups across meningioma and non-pathological meningeal tissue combined. ACTB, a significant upregulated gene in abdominal aortic aneurysm samples, could be regulated by CLIC4, which was significantly enriched in cell motions. Dystonia-deafness syndrome is a well-known clinical entity, with sensorineural deafness typically manifesting earlier than dystonia. ACTB p.Arg183Trp heterozygosity has been reported in six patients to cause combined infant-onset deafness and dystonia manifesting in adolescence or young adulthood.
Full Name
actin, beta

beta-Actin cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
beta-Actin cDNA ORF Clone in Cloning Vector, Rat RG81089-U
beta-Actin cDNA ORF Clone, Rat, untagged RG81089-UT
beta-Actin Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81089-ACGLN
beta-Actin cDNA ORF Clone, Rat, C-GFPSpark® tag RG81089-ACG
beta-Actin cDNA ORF Clone, Rat, N-GFPSpark® tag RG81089-ANG
beta-Actin cDNA ORF Clone, Rat, C-OFPSpark® tag RG81089-ACR
beta-Actin cDNA ORF Clone, Rat, N-OFPSpark® tag RG81089-ANR
beta-Actin cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81089-CF
beta-Actin cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81089-NF
beta-Actin cDNA ORF Clone, Rat, C-His tag RG81089-CH
beta-Actin cDNA ORF Clone, Rat, N-His tag RG81089-NH
beta-Actin cDNA ORF Clone, Rat, C-HA tag RG81089-CY
beta-Actin cDNA ORF Clone, Rat, N-HA tag RG81089-NY
beta-Actin cDNA ORF Clone, Rat, C-Myc tag RG81089-CM
beta-Actin cDNA ORF Clone, Rat, N-Myc tag RG81089-NM
beta-Actin qPCR Primer Pairs, Rat RP301046

beta-Actin cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
beta-Actin cDNA ORF Clone in Cloning Vector, Mouse MG57265-U
beta-Actin cDNA ORF Clone, Mouse, untagged MG57265-UT
beta-Actin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57265-ACG
beta-Actin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG57265-ACGLN
beta-Actin cDNA ORF Clone, Mouse, N-GFPSpark® tag MG57265-ANG
beta-Actin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG57265-ACR
beta-Actin cDNA ORF Clone, Mouse, N-OFPSpark® tag MG57265-ANR
beta-Actin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG57265-CF
beta-Actin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG57265-NF
beta-Actin cDNA ORF Clone, Mouse, C-His tag MG57265-CH
beta-Actin cDNA ORF Clone, Mouse, N-His tag MG57265-NH
beta-Actin cDNA ORF Clone, Mouse, C-HA tag MG57265-CY
beta-Actin cDNA ORF Clone, Mouse, N-HA tag MG57265-NY
beta-Actin cDNA ORF Clone, Mouse, C-Myc tag MG57265-CM
beta-Actin cDNA ORF Clone, Mouse, N-Myc tag MG57265-NM

beta-Actin cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
beta-Actin cDNA ORF Clone in Cloning Vector, Human HG10962-M
beta-Actin cDNA ORF Clone, Human, untagged HG10962-UT
beta-Actin cDNA ORF Clone, Human, C-GFPSpark® tag HG10962-ACG
beta-Actin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10962-ACGLN
beta-Actin cDNA ORF Clone, Human, N-GFPSpark® tag HG10962-ANG
beta-Actin cDNA ORF Clone, Human, C-OFPSpark® tag HG10962-ACR
beta-Actin cDNA ORF Clone, Human, N-OFPSpark® tag HG10962-ANR
beta-Actin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10962-NF
beta-Actin cDNA ORF Clone, Human, C-His tag HG10962-CH
beta-Actin cDNA ORF Clone, Human, N-His tag HG10962-NH
beta-Actin cDNA ORF Clone, Human, C-HA tag HG10962-CY
beta-Actin cDNA ORF Clone, Human, N-HA tag HG10962-NY
beta-Actin cDNA ORF Clone, Human, C-Myc tag HG10962-CM
beta-Actin cDNA ORF Clone, Human, N-Myc tag HG10962-NM
beta-Actin qPCR Primer Pairs, Human HP100001
info info
添加购物车成功! 添加购物车失败!