Actin cDNA ORF Clone, Human, N-Myc tag

Cat: HG10956-NM

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All Actin Reagents

CRO Services

Product recommended


All Actin Reagents

Actin cDNA ORF Clone, Human, N-Myc tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1134 bp
Description
Full length Clone DNA of Human actin, alpha 1, skeletal muscle with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Actin cDNA ORF Clone, Human, N-Myc tag Alternative Names

ACTA cDNA ORF Clone, Human;ASMA cDNA ORF Clone, Human;CFTD cDNA ORF Clone, Human;CFTD1 cDNA ORF Clone, Human;CFTDM cDNA ORF Clone, Human;MPFD cDNA ORF Clone, Human;NEM1 cDNA ORF Clone, Human;NEM2 cDNA ORF Clone, Human;NEM3 cDNA ORF Clone, Human

Actin Background Information

Full Name
actin, alpha 1, skeletal muscle

Actin cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Actin cDNA ORF Clone in Cloning Vector, Rat RG80618-U
Actin cDNA ORF Clone, Rat, untagged RG80618-UT
Actin Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80618-ACGLN
Actin cDNA ORF Clone, Rat, C-GFPSpark® tag RG80618-ACG
Actin cDNA ORF Clone, Rat, N-GFPSpark® tag RG80618-ANG
Actin cDNA ORF Clone, Rat, C-OFPSpark® tag RG80618-ACR
Actin cDNA ORF Clone, Rat, N-OFPSpark® tag RG80618-ANR
Actin cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80618-CF
Actin cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80618-NF
Actin cDNA ORF Clone, Rat, C-His tag RG80618-CH
Actin cDNA ORF Clone, Rat, N-His tag RG80618-NH
Actin cDNA ORF Clone, Rat, C-HA tag RG80618-CY
Actin cDNA ORF Clone, Rat, N-HA tag RG80618-NY
Actin cDNA ORF Clone, Rat, C-Myc tag RG80618-CM
Actin cDNA ORF Clone, Rat, N-Myc tag RG80618-NM
Actin qPCR Primer Pairs, Rat RP300582

Actin cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Actin cDNA ORF Clone in Cloning Vector, Mouse MG51017-G
Actin cDNA ORF Clone, Mouse, untagged MG51017-UT
Actin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51017-ACGLN
Actin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51017-ACG
Actin cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51017-ANG
Actin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51017-ACR
Actin cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51017-ANR
Actin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51017-CF
Actin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51017-NF
Actin cDNA ORF Clone, Mouse, C-His tag MG51017-CH
Actin cDNA ORF Clone, Mouse, N-His tag MG51017-NH
Actin cDNA ORF Clone, Mouse, C-HA tag MG51017-CY
Actin cDNA ORF Clone, Mouse, N-HA tag MG51017-NY
Actin cDNA ORF Clone, Mouse, C-Myc tag MG51017-CM
Actin cDNA ORF Clone, Mouse, N-Myc tag MG51017-NM
Actin qPCR Primer Pairs, Mouse MP200976

Actin cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Actin cDNA ORF Clone in Cloning Vector, Human HG10956-M
Actin cDNA ORF Clone, Human, untagged HG10956-UT
Actin cDNA ORF Clone, Human, C-GFPSpark® tag HG10956-ACG
Actin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10956-ACGLN
Actin cDNA ORF Clone, Human, N-GFPSpark® tag HG10956-ANG
Actin cDNA ORF Clone, Human, C-OFPSpark® tag HG10956-ACR
Actin cDNA ORF Clone, Human, N-OFPSpark® tag HG10956-ANR
Actin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10956-CF
Actin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10956-NF
Actin cDNA ORF Clone, Human, C-His tag HG10956-CH
Actin cDNA ORF Clone, Human, N-His tag HG10956-NH
Actin cDNA ORF Clone, Human, C-HA tag HG10956-CY
Actin cDNA ORF Clone, Human, N-HA tag HG10956-NY
Actin cDNA ORF Clone, Human, C-Myc tag HG10956-CM
Actin qPCR Primer Pairs, Human HP100832
info info
添加购物车成功! 添加购物车失败!