Schnelle Bestellung

Mensch ABCB1 Gene ORF cDNA clone expression plasmid

  • Human ABCB1 natural ORF mammalian expression plasmid
DatenblattBewertungenÄhnliche ProdukteProtokolle
Mensch ABCB1 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_000927
cDNA-Größe:3843bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens ATP-binding cassette, sub-family B (MDR/TAP), member 1.
Synonyme für Gene:P-gp, CD243, GP170, ABC20
Spezies:Human
Vektor:pCMV3-untagged
Plasmid:pCMV3-ABCB1
Restriktionsschnittstelle:KpnI (two restriction sites) + XbaI (6.1kb + 2.82kb + 1.07kb)
Tag-Sequenz:
Sequenzbeschreibung:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 3435T>C not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with ABCB1 qPCR primers for gene expression analysis, HP101566 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Mensch ABCB1 Gene Plasmid Map
Human ABCB1 natural ORF mammalian expression plasmid
Product nameProduct name
Size / Price
Katalog: HG12030-UT
Listenpreis: 
Preis:      (You Save: )

Datasheet & Documentation

All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“