HRG / HPRG cDNA ORF Clone, Human, C-DDK (Flag®) tag

1/1

This product is not available, please contact order_us@sinobiological.com for relevant product if required.

HRG / HPRG cDNA ORF Clone, Human, C-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1578 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human histidine-rich glycoprotein DNA.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV2-FLAG
Restriction Sites
KpnI + XhoI
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

HRG / HPRG cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HRG / HPRG cDNA ORF Clone, Human, C-DDK (Flag®) tag: Validated Images

The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope.

HRG / HPRG cDNA ORF Clone, Human, C-DDK (Flag®) tag: Alternative Names

HPRG cDNA ORF Clone, Human; HRGP cDNA ORF Clone, Human; THPH11 cDNA ORF Clone, Human

HRG / HPRG Background Information

Histidine-rich glycoprotein, also known as HRG and HPRG, is a glycoprotein located in plasma and platelets, and contains an unusually large amount of histidine and proline. In human, five distinct domains are recognized in the mature HPRG molecule. There are two N-terminal cystatin-like modules (aa 19 - 254) and one His-Pro-rich region (aa 35 - 497) that is flanked by two Pro-rich segments (aa 276 - 321 and 498 - 525). The His-Pro-rich region contains 1 tandem repeats with an HHPHG motif, and the N- and C-termini are linked by a disulfide bond. The specific functions of HRG remain unclear, but it is known that the protein binds heme, dyes and divalent metal ions. It inhibits rosette formation and interacts with heparin, thrombospondin and plasminogen. Two of the protein's effects, the inhibition of fibrinolysis and the reduction of inhibition of coagulation, indicate a potential prothrombotic effect. HPRG is evolutionarily, functionally and structurally related to cleaved high molecular weight kininogen (HKa), an anti-angiogenic polypeptide that stimulates apoptosis of proliferating endothelial cells through binding to cell-surface tropomyosin. The antiangiogenic activity of the multidomain plasma protein HPRG is localized to its histidine-proline-rich (H/P) domain and has recently been shown to be mediated, at least partially, through binding to cell-surface tropomyosin in fibroblast growth factor-2-activated endothelial cells.
Full Name
histidine-rich glycoprotein
References
  • Guan X, et al. (2004) Histidine-proline rich glycoprotein (HPRG) binds and transduces anti-angiogenic signals through cell surface tropomyosin on endothelial cells. Thromb Haemost. 92(2): 403-12.
  • Doate F, et al. (2004) Peptides derived from the histidine-proline domain of the histidine-proline-rich glycoprotein bind to tropomyosin and have antiangiogenic and antitumor activities. Cancer Res. 64(16): 5812-7.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait