Schnelle Bestellung

Mensch HLA-A Gene ORF cDNA clone expression plasmid

  • Human HLA-A Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
DatenblattBewertungenÄhnliche ProdukteProtokolle
Mensch HLA-A Produktinformation zum cDNA-Klon
Gene_bank_ref_id:
cDNA-Größe:
cDNA-Beschreibung:
Synonyme für Gene:
Spezies:Human
Vektor:
Restriktionsschnittstelle:
Tag-Sequenz:
Sequenzbeschreibung:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:( We provide with HLA-A qPCR primers for gene expression analysis, HP101972 )
Shipping_carrier:
Lagerung:
Mensch HLA-A Gene Plasmid Map
Human HLA-A Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Datasheet & Documentation

Contact Us
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“