Schnelle Bestellung

HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, C-HA tag

    DatenblattBewertungenÄhnliche ProdukteProtokolle
    HIV HIV-gag Produktinformation zum cDNA-Klon
    Gene_bank_ref_id:AB731740.1
    cDNA-Größe:1566bp
    cDNA-Beschreibung:Full length Clone DNA of HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag with C terminal HA tag.
    Synonyme für Gene:HIV-gag
    Spezies:HIV
    Vektor:pCMV3-C-HA
    Plasmid:
    Restriktionsschnittstelle:
    Tag-Sequenz:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Sequenzbeschreibung:Identical with the Gene Bank Ref. ID sequence.
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Lagerung:The lyophilized plasmid can be stored at ambient temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, C-HA tag on other vectors
    HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, C-GFPSpark tagVG40260-ACG$345
    HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40260-ACR$345
    HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, N-GFPSpark tagVG40260-ANG$345
    HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40260-ANR$345
    HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, C-Flag tagVG40260-CF$315
    HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, C-His tagVG40260-CH$315
    HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, C-Myc tagVG40260-CM$315
    HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, C-HA tagVG40260-CY$315
    HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid (Codon Optimized)VG40260-G$115
    HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, N-Flag tagVG40260-NF$315
    HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, N-His tagVG40260-NH$315
    HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, N-Myc tagVG40260-NM$315
    HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag ORF mammalian expression plasmid, N-HA tagVG40260-NY$315
    HIV-2 (subtype CRF01_AB, strain 07JP_NMC716_clone_01) gag natural ORF mammalian expression plasmidVG40260-UT$315
     Erfahren Sie mehr über Expressionsvektoren
    Product nameProduct name
    Size / Price
    Katalog: VG40260-CY
    Listenpreis: 
    Preis:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Kürzlich angesehene Artikel
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“