HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, N-Myc tag

Price:
Size:
Number:

HIV-1 (group M, subtype B, strain HXB2) gag ORF mammalian expression plasmid, N-Myc tag: General Information

Gene
Species
HIV
NCBI Ref Seq
RefSeq ORF Size
1503 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of HIV-1 (group M, subtype B, strain HXB2) gag with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

HIV Gag polyprotein cDNA ORF Clone, HIV, Related Products

Add to Cart Successfully Add to Cart Failed