After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, N-His tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
HIV HIV-gag Produktinformation zum cDNA-Klon
Gene_bank_ref_id:U51190.1
cDNA-Größe:1500bp
cDNA-Beschreibung:Full length Clone DNA of HIV-1 (group M, subtype A, strain 92UG037.1) gag with N terminal His tag.
Synonyme für Gene:HIV-gag
Spezies:HIV
Vektor:pCMV3-N-His
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequenzbeschreibung:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, N-His tag on other vectors
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, C-GFPSpark tagVG40241-ACG$325
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40241-ACR$325
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, N-GFPSpark tagVG40241-ANG$325
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40241-ANR$325
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, C-Flag tagVG40241-CF$295
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, C-His tagVG40241-CH$295
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, C-Myc tagVG40241-CM$295
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, C-HA tagVG40241-CY$295
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid (Codon Optimized)VG40241-G$95
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, N-Flag tagVG40241-NF$295
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, N-His tagVG40241-NH$295
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, N-Myc tagVG40241-NM$295
HIV-1 (group M, subtype A, strain 92UG037.1) gag ORF mammalian expression plasmid, N-HA tagVG40241-NY$295
HIV-1 (group M, subtype A, strain 92UG037.1) gag natural ORF mammalian expression plasmidVG40241-UT$295
 Erfahren Sie mehr über Expressionsvektoren
Product nameProduct name
Size / Price
Katalog: VG40241-NH
Listenpreis: 
Preis:      (You Save: )
Größe:
Menge:+-
Verfügbarkeit2-3 weeks
Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
Contact Us
Bilder
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“