After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

Mensch ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Gene ORF cDNA clone expression plasmid, C-Myc tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Human ITGB1 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_002211.3
cDNA-Größe:2397bp
cDNA-Beschreibung:Full length Clone DNA of Homo sapiens integrin, beta 1 (fibronectin receptor, beta polypeptide, antigen CD29 includes MDF2, MSK12), transcript variant 1A with C terminal Myc tag.
Synonyme für Gene:CD29, FNRB, MDF2, VLAB, GPIIA, MSK12, VLA-BETA
Spezies:Human
Vektor:pCMV3-C-Myc
Plasmid:pCMV3-ITGB1-Myc
Restriktionsschnittstelle:KpnI + XbaI (6kb + 2.44kb)
Tag-Sequenz:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequenzbeschreibung:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 459T/C not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Human ITGB1 Gene Plasmid Map
HHuman Integrin beta1 transcript variant 1A ORF mammalian expression plasmid, C-Myc tag
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Mensch ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Gene ORF cDNA clone expression plasmid, C-Myc tag on other vectors
Mensch ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG10587-ACG$245
Mensch ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG10587-ACR$245
Mensch ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG10587-ANG$245
Mensch ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG10587-ANR$245
Mensch ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Gene ORF cDNA clone expression plasmid, C-Flag tagHG10587-CF$215
Mensch ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Gene ORF cDNA clone expression plasmid, C-His tagHG10587-CH$215
Mensch ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Gene ORF cDNA clone expression plasmid, C-Myc tagHG10587-CM$215
Mensch ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Gene ORF cDNA clone expression plasmid, C-HA tagHG10587-CY$215
Mensch ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Gene ORF cDNA clone in cloning vectorHG10587-M$75
Mensch ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Gene ORF cDNA clone expression plasmid, N-Flag tagHG10587-NF$215
Mensch ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Gene ORF cDNA clone expression plasmid, N-His tagHG10587-NH$215
Mensch ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Gene ORF cDNA clone expression plasmid, N-Myc tagHG10587-NM$215
Mensch ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Gene ORF cDNA clone expression plasmid, N-HA tagHG10587-NY$215
Mensch ITGB1 / Integrin beta-1 / CD29 transcript variant 1A Gene ORF cDNA clone expression plasmidHG10587-UT$215
 Erfahren Sie mehr über Expressionsvektoren
Product nameProduct name
Size / Price
Katalog: HG10587-CM
Listenpreis: 
Preis:      (You Save: )
Größe:
Menge:+-
VerfügbarkeitIn Stock
Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
Contact Us
Bilder
  • HHuman Integrin beta1 transcript variant 1A ORF mammalian expression plasmid, C-Myc tag
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“