Schnelle Bestellung

Frettchen METTL3/Methyltransferase like 3 Gene ORF cDNA clone expression plasmid, N-HA tag

    DatenblattBewertungenÄhnliche ProdukteProtokolle
    Frettchen METTL3 Produktinformation zum cDNA-Klon
    Gene_bank_ref_id:XM_004758578.1
    cDNA-Größe:1743bp
    cDNA-Beschreibung:Full length Clone DNA of Mustela putorius furo (sub-species: furo) methyltransferase like 3 with N terminal HA tag.
    Synonyme für Gene:METTL3
    Spezies:Ferret
    Vektor:pCMV3-N-HA
    Plasmid:
    Restriktionsschnittstelle:
    Tag-Sequenz:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Sequenzbeschreibung:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Frettchen METTL3/Methyltransferase like 3 Gene ORF cDNA clone expression plasmid, N-HA tag on other vectors
    Frettchen METTL3/Methyltransferase like 3 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagFG60040-ACG$245
    Frettchen METTL3/Methyltransferase like 3 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagFG60040-ACR$245
    Frettchen METTL3/Methyltransferase like 3 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagFG60040-ANG$245
    Frettchen METTL3/Methyltransferase like 3 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagFG60040-ANR$245
    Frettchen METTL3/Methyltransferase like 3 Gene ORF cDNA clone expression plasmid, C-Flag tagFG60040-CF$215
    Frettchen METTL3/Methyltransferase like 3 Gene ORF cDNA clone expression plasmid, C-His tagFG60040-CH$215
    Frettchen METTL3/Methyltransferase like 3 Gene ORF cDNA clone expression plasmid, C-Myc tagFG60040-CM$215
    Frettchen METTL3/Methyltransferase like 3 Gene ORF cDNA clone expression plasmid, C-HA tagFG60040-CY$215
    Frettchen METTL3/Methyltransferase like 3 Gene ORF cDNA clone in cloning vectorFG60040-G$75
    Frettchen METTL3/Methyltransferase like 3 Gene ORF cDNA clone expression plasmid, N-Flag tagFG60040-NF$215
    Frettchen METTL3/Methyltransferase like 3 Gene ORF cDNA clone expression plasmid, N-His tagFG60040-NH$215
    Frettchen METTL3/Methyltransferase like 3 Gene ORF cDNA clone expression plasmid, N-Myc tagFG60040-NM$215
    Frettchen METTL3/Methyltransferase like 3 Gene ORF cDNA clone expression plasmid, N-HA tagFG60040-NY$215
    Frettchen METTL3/Methyltransferase like 3 Gene ORF cDNA clone expression plasmidFG60040-UT$215
     Erfahren Sie mehr über Expressionsvektoren
    Product nameProduct name
    Size / Price
    Katalog: FG60040-NY
    Listenpreis: 
    Preis:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“