After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

Frettchen METTL3/Methyltransferase like 3 Gene ORF cDNA clone expression plasmid, C-HA tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Ferret METTL3 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:XM_004758578.1
cDNA-Größe:1743bp
cDNA-Beschreibung:Full length Clone DNA of Mustela putorius furo (sub-species: furo) methyltransferase like 3 with C terminal HA tag.
Synonyme für Gene:METTL3
Spezies:Ferret
Vektor:pCMV3-C-HA
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Frettchen METTL3/Methyltransferase like 3 Gene ORF cDNA clone expression plasmid, C-HA tag on other vectors
Frettchen METTL3/Methyltransferase like 3 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagFG60040-ACG$245
Frettchen METTL3/Methyltransferase like 3 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagFG60040-ACR$245
Frettchen METTL3/Methyltransferase like 3 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagFG60040-ANG$245
Frettchen METTL3/Methyltransferase like 3 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagFG60040-ANR$245
Frettchen METTL3/Methyltransferase like 3 Gene ORF cDNA clone expression plasmid, C-Flag tagFG60040-CF$215
Frettchen METTL3/Methyltransferase like 3 Gene ORF cDNA clone expression plasmid, C-His tagFG60040-CH$215
Frettchen METTL3/Methyltransferase like 3 Gene ORF cDNA clone expression plasmid, C-Myc tagFG60040-CM$215
Frettchen METTL3/Methyltransferase like 3 Gene ORF cDNA clone expression plasmid, C-HA tagFG60040-CY$215
Frettchen METTL3/Methyltransferase like 3 Gene ORF cDNA clone in cloning vectorFG60040-G$75
Frettchen METTL3/Methyltransferase like 3 Gene ORF cDNA clone expression plasmid, N-Flag tagFG60040-NF$215
Frettchen METTL3/Methyltransferase like 3 Gene ORF cDNA clone expression plasmid, N-His tagFG60040-NH$215
Frettchen METTL3/Methyltransferase like 3 Gene ORF cDNA clone expression plasmid, N-Myc tagFG60040-NM$215
Frettchen METTL3/Methyltransferase like 3 Gene ORF cDNA clone expression plasmid, N-HA tagFG60040-NY$215
Frettchen METTL3/Methyltransferase like 3 Gene ORF cDNA clone expression plasmidFG60040-UT$215
 Erfahren Sie mehr über Expressionsvektoren
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“