After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Frettchen ENO1 / Enolase 1 / alpha-enolase Gene ORF cDNA clone expression plasmid, N-Flag tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Ferret ENO1 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:XM_004768617.1
cDNA-Größe:1305bp
cDNA-Beschreibung:Full length Clone DNA of Mustela putorius furo (sub-species: furo) enolase 1, (alpha) with N terminal Flag tag.
Synonyme für Gene:ENO1
Spezies:Ferret
Vektor:pCMV3-N-FLAG
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Frettchen ENO1 / Enolase 1 / alpha-enolase Gene ORF cDNA clone expression plasmid, N-Flag tag on other vectors
Frettchen ENO1 / Enolase 1 / alpha-enolase Gene ORF cDNA clone expression plasmid, C-GFPSpark tagFG60094-ACG$225
Frettchen ENO1 / Enolase 1 / alpha-enolase Gene ORF cDNA clone expression plasmid, C-OFPSpark tagFG60094-ACR$225
Frettchen ENO1 / Enolase 1 / alpha-enolase Gene ORF cDNA clone expression plasmid, N-GFPSpark tagFG60094-ANG$225
Frettchen ENO1 / Enolase 1 / alpha-enolase Gene ORF cDNA clone expression plasmid, N-OFPSpark tagFG60094-ANR$225
Frettchen ENO1 / Enolase 1 / alpha-enolase Gene ORF cDNA clone expression plasmid, C-Flag tagFG60094-CF$195
Frettchen ENO1 / Enolase 1 / alpha-enolase Gene ORF cDNA clone expression plasmid, C-His tagFG60094-CH$195
Frettchen ENO1 / Enolase 1 / alpha-enolase Gene ORF cDNA clone expression plasmid, C-Myc tagFG60094-CM$195
Frettchen ENO1 / Enolase 1 / alpha-enolase Gene ORF cDNA clone expression plasmid, C-HA tagFG60094-CY$195
Frettchen ENO1 / Enolase 1 / alpha-enolase Gene ORF cDNA clone in cloning vectorFG60094-G$75
Frettchen ENO1 / Enolase 1 / alpha-enolase Gene ORF cDNA clone expression plasmid, N-Flag tagFG60094-NF$195
Frettchen ENO1 / Enolase 1 / alpha-enolase Gene ORF cDNA clone expression plasmid, N-His tagFG60094-NH$195
Frettchen ENO1 / Enolase 1 / alpha-enolase Gene ORF cDNA clone expression plasmid, N-Myc tagFG60094-NM$195
Frettchen ENO1 / Enolase 1 / alpha-enolase Gene ORF cDNA clone expression plasmid, N-HA tagFG60094-NY$195
Frettchen ENO1 / Enolase 1 / alpha-enolase Gene ORF cDNA clone expression plasmidFG60094-UT$195
 Erfahren Sie mehr über Expressionsvektoren
Product nameProduct name
Referenzen
  • Capello M, et al. (2011) a-Enolase: a promising therapeutic and diagnostic tumor target. FEBS J. 278(7): 1064-74.
  • Kang HJ, et al. (2008) Structure of human alpha-enolase (hENO1), a multifunctional glycolytic enzyme. Acta Crystallogr D Biol Crystallogr. 64(Pt 6): 651-7.
  • Lopez-Alemany R, et al. (2005) Alpha-enolase plasminogen receptor in myogenesis. Front Biosci. 10: 30-6.
  • Ejeskdr K, et al. (2005) Introduction of in vitro transcribed ENO1 mRNA into neuroblastoma cells induces cell death. BMC Cancer. 5: 161.
  • Size / Price
    Katalog: FG60094-NF
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    Verfügbarkeit2-3 weeks
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    Bilder
        Kürzlich angesehene Artikel
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“