Schnelle Bestellung

Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid, C-HA tag

    DatenblattBewertungenÄhnliche ProdukteProtokolle
    DENV DENV-NS4B Produktinformation zum cDNA-Klon
    Gene_bank_ref_id:AF038403.1
    cDNA-Größe:744bp
    cDNA-Beschreibung:Full length Clone DNA of DENV-2 (strain New Guinea C) NS4B with C terminal HA tag.
    Synonyme für Gene:DENV-NS4B
    Spezies:DENV
    Vektor:pCMV3-C-HA
    Plasmid:
    Restriktionsschnittstelle:
    Tag-Sequenz:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Sequenzbeschreibung:Identical with the Gene Bank Ref. ID sequence AF038403.1 (6826..7569), corresponding to amino acid sequence AAC59275.1 (aa 2244-2491).
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Lagerung:The lyophilized plasmid can be stored at ambient temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid, C-HA tag on other vectors
    Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid, C-GFPSpark tagVG40266-ACG$325
    Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40266-ACR$325
    Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid, N-GFPSpark tagVG40266-ANG$325
    Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40266-ANR$325
    Dengue virus DENV-2 (strain New Guinea C) NS4B Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedVG40266-CF$295
    Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid, C-His tagVG40266-CH$295
    Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid, C-Myc tagVG40266-CM$295
    Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid, C-HA tagVG40266-CY$295
    Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid (Codon Optimized)VG40266-G$95
    Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid, N-Flag tagVG40266-NF$295
    Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid, N-His tagVG40266-NH$295
    Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid, N-Myc tagVG40266-NM$295
    Dengue virus DENV-2 (strain New Guinea C) NS4B ORF mammalian expression plasmid, N-HA tagVG40266-NY$295
    Dengue virus DENV-2 (strain New Guinea C) NS4B natural ORF mammalian expression plasmidVG40266-UT$295
     Erfahren Sie mehr über Expressionsvektoren
    Product nameProduct name
    Size / Price
    Katalog: VG40266-CY
    Listenpreis: 
    Preis:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“