After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

Dengue virus DENV-2 (strain New Guinea C) NS4A ORF mammalian expression plasmid, C-HA tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
DENV DENV-NS4A Produktinformation zum cDNA-Klon
Gene_bank_ref_id:AF038403.1
cDNA-Größe:381bp
cDNA-Beschreibung:Full length Clone DNA of DENV-2 (strain New Guinea C) NS4A with C terminal HA tag.
Synonyme für Gene:DENV-NS4A
Spezies:DENV
Vektor:pCMV3-C-HA
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequenzbeschreibung:Identical with the Gene Bank Ref. ID sequence AF038403.1 (6376..6756), corresponding to amino acid sequence AAC59275.1 (aa 2094-2220).
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at ambient temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Dengue virus DENV-2 (strain New Guinea C) NS4A ORF mammalian expression plasmid, C-HA tag on other vectors
Dengue virus DENV-2 (strain New Guinea C) NS4A ORF mammalian expression plasmid, C-GFPSpark tagVG40265-ACG$325
Dengue virus DENV-2 (strain New Guinea C) NS4A ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40265-ACR$325
Dengue virus DENV-2 (strain New Guinea C) NS4A ORF mammalian expression plasmid, N-GFPSpark tagVG40265-ANG$325
Dengue virus DENV-2 (strain New Guinea C) NS4A ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40265-ANR$325
Dengue virus DENV-2 (strain New Guinea C) NS4A ORF mammalian expression plasmid, C-Flag tagVG40265-CF$295
Dengue virus DENV-2 (strain New Guinea C) NS4A ORF mammalian expression plasmid, C-His tagVG40265-CH$295
Dengue virus DENV-2 (strain New Guinea C) NS4A ORF mammalian expression plasmid, C-Myc tagVG40265-CM$295
Dengue virus DENV-2 (strain New Guinea C) NS4A ORF mammalian expression plasmid, C-HA tagVG40265-CY$295
Dengue virus DENV-2 (strain New Guinea C) NS4A ORF mammalian expression plasmid (Codon Optimized)VG40265-G$95
Dengue virus DENV-2 (strain New Guinea C) NS4A ORF mammalian expression plasmid, N-Flag tagVG40265-NF$295
Dengue virus DENV-2 (strain New Guinea C) NS4A ORF mammalian expression plasmid, N-His tagVG40265-NH$295
Dengue virus DENV-2 (strain New Guinea C) NS4A ORF mammalian expression plasmid, N-Myc tagVG40265-NM$295
Dengue virus DENV-2 (strain New Guinea C) NS4A ORF mammalian expression plasmid, N-HA tagVG40265-NY$295
Dengue virus DENV-2 (strain New Guinea C) NS4A natural ORF mammalian expression plasmidVG40265-UT$295
 Erfahren Sie mehr über Expressionsvektoren
Product nameProduct name
Size / Price
Katalog: VG40265-CY
Listenpreis: 
Preis:      (You Save: )
Größe:
Menge:+-
Verfügbarkeit2-3 weeks
Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
Contact Us
Bilder
      Kürzlich angesehene Artikel
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“