UQCRC2 cDNA ORF Clone, Rhesus, N-Myc tag

Cat: CG90393-NM

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All UQCRC2 Reagents

CRO Services

Product recommended


All UQCRC2 Reagents

UQCRC2 cDNA ORF Clone, Rhesus, N-Myc tag General Information

Gene

Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1362 bp
Description
Full length Clone DNA of Rhesus ubiquinol-cytochrome c reductase core protein II with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

UQCRC2 Background Information

Ubiquinol-cytochrome-c reductase core protein 2 (UQCRC2) is a component of ubiquinol-cytochrome c reductase complex that is known to correlate with male fertility via spermatogenesis. Simultaneously, nutlin-3a is a small molecule antagonist of mouse double minute 2 repressor (MDM2), activate p53 and induce apoptosis responsible for spermatogenesis. UQCRC2 can also interactive with NLRX1, the only member of the Nod-like receptor (NLR) family, providing a molecular basis for the role of NLRX1 in ROS generation.
Full Name
ubiquinol-cytochrome c reductase core protein II

UQCRC2 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
UQCRC2 cDNA ORF Clone in Cloning Vector, Rhesus CG90393-G
UQCRC2 cDNA ORF Clone, Rhesus, untagged CG90393-UT
UQCRC2 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90393-ACG
UQCRC2 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90393-ACGLN
UQCRC2 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90393-ANG
UQCRC2 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90393-ACR
UQCRC2 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90393-ANR
UQCRC2 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90393-CF
UQCRC2 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90393-NF
UQCRC2 cDNA ORF Clone, Rhesus, C-His tag CG90393-CH
UQCRC2 cDNA ORF Clone, Rhesus, N-His tag CG90393-NH
UQCRC2 cDNA ORF Clone, Rhesus, C-HA tag CG90393-CY
UQCRC2 cDNA ORF Clone, Rhesus, N-HA tag CG90393-NY
UQCRC2 cDNA ORF Clone, Rhesus, C-Myc tag CG90393-CM

UQCRC2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
UQCRC2 cDNA ORF Clone in Cloning Vector, Rat RG80884-U
UQCRC2 cDNA ORF Clone, Rat, untagged RG80884-UT
UQCRC2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80884-ACGLN
UQCRC2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80884-ACG
UQCRC2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80884-ANG
UQCRC2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80884-ACR
UQCRC2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80884-ANR
UQCRC2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80884-CF
UQCRC2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80884-NF
UQCRC2 cDNA ORF Clone, Rat, C-His tag RG80884-CH
UQCRC2 cDNA ORF Clone, Rat, N-His tag RG80884-NH
UQCRC2 cDNA ORF Clone, Rat, C-HA tag RG80884-CY
UQCRC2 cDNA ORF Clone, Rat, N-HA tag RG80884-NY
UQCRC2 cDNA ORF Clone, Rat, C-Myc tag RG80884-CM
UQCRC2 cDNA ORF Clone, Rat, N-Myc tag RG80884-NM
UQCRC2 qPCR Primer Pairs, Rat RP300848

UQCRC2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
UQCRC2 cDNA ORF Clone in Cloning Vector, Mouse MG51539-U
UQCRC2 cDNA ORF Clone, Mouse, untagged MG51539-UT
UQCRC2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51539-ACG
UQCRC2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51539-ACGLN
UQCRC2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51539-ANG
UQCRC2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51539-ACR
UQCRC2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51539-ANR
UQCRC2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51539-CF
UQCRC2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51539-NF
UQCRC2 cDNA ORF Clone, Mouse, C-His tag MG51539-CH
UQCRC2 cDNA ORF Clone, Mouse, N-His tag MG51539-NH
UQCRC2 cDNA ORF Clone, Mouse, C-HA tag MG51539-CY
UQCRC2 cDNA ORF Clone, Mouse, N-HA tag MG51539-NY
UQCRC2 cDNA ORF Clone, Mouse, C-Myc tag MG51539-CM
UQCRC2 cDNA ORF Clone, Mouse, N-Myc tag MG51539-NM
UQCRC2 qPCR Primer Pairs, Mouse MP201423

UQCRC2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
UQCRC2 cDNA ORF Clone in Cloning Vector, Human HG16321-G
UQCRC2 cDNA ORF Clone, Human, untagged HG16321-UT
UQCRC2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16321-ACGLN
UQCRC2 cDNA ORF Clone, Human, C-GFPSpark® tag HG16321-ACG
UQCRC2 cDNA ORF Clone, Human, N-GFPSpark® tag HG16321-ANG
UQCRC2 cDNA ORF Clone, Human, C-OFPSpark® tag HG16321-ACR
UQCRC2 cDNA ORF Clone, Human, N-OFPSpark® tag HG16321-ANR
UQCRC2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16321-CF
UQCRC2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16321-NF
UQCRC2 cDNA ORF Clone, Human, C-His tag HG16321-CH
UQCRC2 cDNA ORF Clone, Human, N-His tag HG16321-NH
UQCRC2 cDNA ORF Clone, Human, C-HA tag HG16321-CY
UQCRC2 cDNA ORF Clone, Human, N-HA tag HG16321-NY
UQCRC2 cDNA ORF Clone, Human, C-Myc tag HG16321-CM
UQCRC2 cDNA ORF Clone, Human, N-Myc tag HG16321-NM
UQCRC2 qPCR Primer Pairs, Human HP105075
info info
添加购物车成功! 添加购物车失败!