TMEM55B cDNA ORF Clone, Rhesus, C-HA tag

Cat: CG90707-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All TMEM55B Reagents
CRO Services
Product recommended

All TMEM55B Reagents
TMEM55B cDNA ORF Clone, Rhesus, C-HA tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
834 bp
Description
Full length Clone DNA of Rhesus transmembrane protein 55B with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TMEM55B Background Information
Full Name
transmembrane protein 55B

TMEM55B cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
TMEM55B cDNA ORF Clone in Cloning Vector, Rhesus CG90707-G
TMEM55B cDNA ORF Clone, Rhesus, untagged CG90707-UT
TMEM55B Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90707-ACGLN
TMEM55B cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90707-ACG
TMEM55B cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90707-ANG
TMEM55B cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90707-ACR
TMEM55B cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90707-ANR
TMEM55B cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90707-CF
TMEM55B cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90707-NF
TMEM55B cDNA ORF Clone, Rhesus, C-His tag CG90707-CH
TMEM55B cDNA ORF Clone, Rhesus, N-His tag CG90707-NH
TMEM55B cDNA ORF Clone, Rhesus, N-HA tag CG90707-NY
TMEM55B cDNA ORF Clone, Rhesus, C-Myc tag CG90707-CM
TMEM55B cDNA ORF Clone, Rhesus, N-Myc tag CG90707-NM

TMEM55B cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TMEM55B cDNA ORF Clone in Cloning Vector, Mouse MG52836-G
TMEM55B cDNA ORF Clone, Mouse, untagged MG52836-UT
TMEM55B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52836-ACG
TMEM55B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52836-ACGLN
TMEM55B cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52836-ANG
TMEM55B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52836-ACR
TMEM55B cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52836-ANR
TMEM55B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52836-CF
TMEM55B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52836-NF
TMEM55B cDNA ORF Clone, Mouse, C-His tag MG52836-CH
TMEM55B cDNA ORF Clone, Mouse, N-His tag MG52836-NH
TMEM55B cDNA ORF Clone, Mouse, C-HA tag MG52836-CY
TMEM55B cDNA ORF Clone, Mouse, N-HA tag MG52836-NY
TMEM55B cDNA ORF Clone, Mouse, C-Myc tag MG52836-CM
TMEM55B cDNA ORF Clone, Mouse, N-Myc tag MG52836-NM

TMEM55B cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TMEM55B cDNA ORF Clone, Human, untagged HG23601-UT
info info
添加购物车成功! 添加购物车失败!