Schnelle Bestellung

Rhesus TIMM13 Gene ORF cDNA clone expression plasmid, C-His tag

    DatenblattBewertungenÄhnliche ProdukteProtokolle
    Cynomolgus TIMM13 Produktinformation zum cDNA-Klon
    Gene_bank_ref_id:NM_001261039.1
    cDNA-Größe:288bp
    cDNA-Beschreibung:Full length Clone DNA of Macaca mulatta (Rhesus monkey) translocase of inner mitochondrial membrane 13 homolog (yeast) with C terminal His tag.
    Synonyme für Gene:TIMM13
    Spezies:Rhesus
    Vektor:pCMV3-C-His
    Plasmid:
    Restriktionsschnittstelle:
    Tag-Sequenz:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequenzbeschreibung:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Product nameProduct name
    Size / Price
    Katalog: CG90820-CH
    Listenpreis: 
    Preis:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“