SNAP-25 cDNA ORF Clone, Cynomolgus, C-His tag

Cat: CG90343-CH

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All SNAP-25 Reagents

CRO Services

Product recommended


All SNAP-25 Reagents

SNAP-25 cDNA ORF Clone, Cynomolgus, C-His tag General Information

Gene

Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
621 bp
Description
Full length Clone DNA of Cynomolgus synaptosomal-associated protein, 25kDa with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SNAP-25 Background Information

Synaptosomal-associated protein 25, also known as Super protein, Synaptosomal-associated 25 kDa protein, SNAP25 and SNAP, is a cytoplasm and cell membrane protein which belongs to the SNAP-25 family. SNAP25 / SUP contains 2 t-SNARE coiled-coil homology domains. SNAP25 / SUP is a membrane bound protein anchored to the cytosolic face of membranes via palmitoyl side chains in the middle of the molecule. SNAP25 / SUP protein is a component of the SNARE complex, which is proposed to account for the specificity of membrane fusion and to directly execute fusion by forming a tight complex that brings the synaptic vesicle and plasma membranes together. SNAP25 / SUP is a Q-SNARE protein contributing two α-helices in the formation of the exocytotic fusion complex in neurons where it assembles with syntaxin-1 and synaptobrevin. SNAP25 / SUP is involved in the molecular regulation of neurotransmitter release. It may play an important role in the synaptic function of specific neuronal systems. SNAP25 / SUP associates with proteins involved in vesicle docking and membrane fusion. SNAP25 / SUP regulates plasma membrane recycling through its interaction with CENPF. SNAP25 / SUP inhibits P/Q- and L-type voltage-gated calcium channels located presynaptically and interacts with the synaptotagmin C2B domain in Ca2+-independent fashion. In glutamatergic synapses SNAP25 / SUP decreases the Ca2+ responsiveness, while it is naturally absent in GABAergic synapses.
Full Name
synaptosomal-associated protein, 25kDa
References
  • Hodel A ,et al.,1998, Int. J. Biochem. Cell Biol. 30 (10): 1069-73.
  • Sudhof TC, et al.,2002, Nat Rev Neurosci 3 (8): 641-653.
  • Chapman ER et al.,2002, Nat. Rev. Mol. Cell Biol. 3(7): 498-508.
  • Chen X., et al., 2002, Neuron 33:397-409.
  • Huang Q., et al., 2008, FEBS Lett. 582:1431-1436.
  • SNAP-25 cDNA ORF Clone, Cynomolgus, Related Products

    Product Name Catalog#(PDF)
    SNAP-25 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90343-G
    SNAP-25 cDNA ORF Clone, Cynomolgus, untagged CG90343-UT
    SNAP-25 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90343-ACGLN
    SNAP-25 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90343-ACG
    SNAP-25 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90343-ANG
    SNAP-25 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90343-ACR
    SNAP-25 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90343-ANR
    SNAP-25 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90343-CF
    SNAP-25 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90343-NF
    SNAP-25 cDNA ORF Clone, Cynomolgus, N-His tag CG90343-NH
    SNAP-25 cDNA ORF Clone, Cynomolgus, C-HA tag CG90343-CY
    SNAP-25 cDNA ORF Clone, Cynomolgus, N-HA tag CG90343-NY
    SNAP-25 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90343-CM
    SNAP-25 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90343-NM

    SNAP-25 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    SNAP-25 cDNA ORF Clone in Cloning Vector, Canine DG70182-U
    SNAP-25 cDNA ORF Clone, Canine, untagged DG70182-UT
    SNAP-25 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70182-ACGLN
    SNAP-25 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70182-ACG
    SNAP-25 cDNA ORF Clone, Canine, N-GFPSpark® tag DG70182-ANG
    SNAP-25 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70182-ACR
    SNAP-25 cDNA ORF Clone, Canine, N-OFPSpark® tag DG70182-ANR
    SNAP-25 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70182-CF
    SNAP-25 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70182-NF
    SNAP-25 cDNA ORF Clone, Canine, C-His tag DG70182-CH
    SNAP-25 cDNA ORF Clone, Canine, N-His tag DG70182-NH
    SNAP-25 cDNA ORF Clone, Canine, C-HA tag DG70182-CY
    SNAP-25 cDNA ORF Clone, Canine, N-HA tag DG70182-NY
    SNAP-25 cDNA ORF Clone, Canine, C-Myc tag DG70182-CM
    SNAP-25 cDNA ORF Clone, Canine, N-Myc tag DG70182-NM

    SNAP-25 cDNA ORF Clone, Rabbit, Related Products

    Product Name Catalog#(PDF)
    SNAP-25 cDNA ORF Clone in Cloning Vector, Rabbit TG65043-G
    SNAP-25 cDNA ORF Clone, Rabbit, untagged TG65043-UT
    SNAP-25 Lentiviral cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65043-ACGLN
    SNAP-25 cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65043-ACG
    SNAP-25 cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65043-ANG
    SNAP-25 cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65043-ACR
    SNAP-25 cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65043-ANR
    SNAP-25 cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65043-CF
    SNAP-25 cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65043-NF
    SNAP-25 cDNA ORF Clone, Rabbit, C-His tag TG65043-CH
    SNAP-25 cDNA ORF Clone, Rabbit, N-His tag TG65043-NH
    SNAP-25 cDNA ORF Clone, Rabbit, C-HA tag TG65043-CY
    SNAP-25 cDNA ORF Clone, Rabbit, N-HA tag TG65043-NY
    SNAP-25 cDNA ORF Clone, Rabbit, C-Myc tag TG65043-CM
    SNAP-25 cDNA ORF Clone, Rabbit, N-Myc tag TG65043-NM

    SNAP-25 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    SNAP-25 cDNA ORF Clone in Cloning Vector, Rat RG81399-G

    SNAP-25 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    SNAP-25 cDNA ORF Clone in Cloning Vector, Mouse MG53887-U
    SNAP-25 cDNA ORF Clone, Mouse, untagged MG53887-UT
    SNAP-25 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53887-ACG
    SNAP-25 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53887-ACGLN
    SNAP-25 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53887-ANG
    SNAP-25 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53887-ACR
    SNAP-25 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53887-ANR
    SNAP-25 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53887-CF
    SNAP-25 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53887-NF
    SNAP-25 cDNA ORF Clone, Mouse, C-His tag MG53887-CH
    SNAP-25 cDNA ORF Clone, Mouse, N-His tag MG53887-NH
    SNAP-25 cDNA ORF Clone, Mouse, C-HA tag MG5A7642-CY
    SNAP-25 cDNA ORF Clone, Mouse, C-HA tag MG53887-CY
    SNAP-25 cDNA ORF Clone, Mouse, N-HA tag MG53887-NY
    SNAP-25 cDNA ORF Clone, Mouse, C-Myc tag MG53887-CM
    SNAP-25 cDNA ORF Clone, Mouse, N-Myc tag MG53887-NM

    SNAP-25 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    SNAP-25 cDNA ORF Clone in Cloning Vector, Human HG11585-M
    SNAP-25 cDNA ORF Clone, Human, untagged HG11585-UT
    SNAP-25 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11585-ACGLN
    SNAP-25 cDNA ORF Clone, Human, C-GFPSpark® tag HG11585-ACG
    SNAP-25 cDNA ORF Clone, Human, N-GFPSpark® tag HG11585-ANG
    SNAP-25 cDNA ORF Clone, Human, C-OFPSpark® tag HG11585-ACR
    SNAP-25 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11585-CF
    SNAP-25 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11585-NF
    SNAP-25 cDNA ORF Clone, Human, C-His tag HG11585-CH
    SNAP-25 cDNA ORF Clone, Human, N-His tag HG11585-NH
    SNAP-25 cDNA ORF Clone, Human, C-HA tag HG11585-CY
    SNAP-25 cDNA ORF Clone, Human, N-HA tag HG11585-NY
    SNAP-25 cDNA ORF Clone, Human, C-Myc tag HG11585-CM
    SNAP-25 cDNA ORF Clone, Human, N-Myc tag HG11585-NM
    SNAP-25 qPCR Primer Pairs, Human HP101451
    info info
    添加购物车成功! 添加购物车失败!