RRNAD1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag

Price:
Size:
Number:

RRNAD1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag: General Information

Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1428 bp
Description
Full length Clone DNA of Rhesus ribosomal RNA adenine dimethylase domain containing 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

RRNAD1 Background Information

Full Name
ribosomal RNA adenine dimethylase domain containing 1

RRNAD1 cDNA ORF Clone, Human, Related Products

Add to Cart Successfully Add to Cart Failed