After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Cynomolgus NNAT/Neuronatin Gene ORF cDNA clone expression plasmid, N-HA tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Cynomolgus NNAT Produktinformation zum cDNA-Klon
Gene_bank_ref_id:XM_005568966.1
cDNA-Größe:165bp
cDNA-Beschreibung:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) neuronatin with N terminal HA tag.
Synonyme für Gene:NNAT
Spezies:Cynomolgus
Vektor:pCMV3-N-HA
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Size / Price
Katalog: CG90414-NY
Listenpreis: 
Preis:      (You Save: )
Größe:
Menge:+-
Verfügbarkeit2-3 weeks
Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
Contact Us
Bilder
      Kürzlich angesehene Artikel
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“