After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

Cynomolgus MSRA/Methionine Mulfoxide Reductase A Gene ORF cDNA clone expression plasmid, C-Myc tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Cynomolgus MSRA Produktinformation zum cDNA-Klon
Gene_bank_ref_id:XM_005562601.1
cDNA-Größe:579bp
cDNA-Beschreibung:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) methionine sulfoxide reductase A with C terminal Myc tag.
Synonyme für Gene:MSRA
Spezies:Cynomolgus
Vektor:pCMV3-C-Myc
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Cynomolgus MSRA/Methionine Mulfoxide Reductase A Gene ORF cDNA clone expression plasmid, C-Myc tag on other vectors
Cynomolgus MSRA/Methionine Mulfoxide Reductase A Gene ORF cDNA clone expression plasmid, C-GFPSpark tagCG90429-ACG$225
Cynomolgus MSRA/Methionine Mulfoxide Reductase A Gene ORF cDNA clone expression plasmid, C-OFPSpark tagCG90429-ACR$225
Cynomolgus MSRA/Methionine Mulfoxide Reductase A Gene ORF cDNA clone expression plasmid, N-GFPSpark tagCG90429-ANG$225
Cynomolgus MSRA/Methionine Mulfoxide Reductase A Gene ORF cDNA clone expression plasmid, N-OFPSpark tagCG90429-ANR$225
Cynomolgus MSRA/Methionine Mulfoxide Reductase A Gene ORF cDNA clone expression plasmid, C-Flag tagCG90429-CF$195
Cynomolgus MSRA/Methionine Mulfoxide Reductase A Gene ORF cDNA clone expression plasmid, C-His tagCG90429-CH$195
Cynomolgus MSRA/Methionine Mulfoxide Reductase A Gene ORF cDNA clone expression plasmid, C-Myc tagCG90429-CM$195
Cynomolgus MSRA/Methionine Mulfoxide Reductase A Gene ORF cDNA clone expression plasmid, C-HA tagCG90429-CY$195
Cynomolgus MSRA/Methionine Mulfoxide Reductase A Gene ORF cDNA clone in cloning vectorCG90429-G$75
Cynomolgus MSRA/Methionine Mulfoxide Reductase A Gene ORF cDNA clone expression plasmid, N-Flag tagCG90429-NF$195
Cynomolgus MSRA/Methionine Mulfoxide Reductase A Gene ORF cDNA clone expression plasmid, N-His tagCG90429-NH$195
Cynomolgus MSRA/Methionine Mulfoxide Reductase A Gene ORF cDNA clone expression plasmid, N-Myc tagCG90429-NM$195
Cynomolgus MSRA/Methionine Mulfoxide Reductase A Gene ORF cDNA clone expression plasmid, N-HA tagCG90429-NY$195
Cynomolgus MSRA/Methionine Mulfoxide Reductase A Gene ORF cDNA clone expression plasmidCG90429-UT$195
 Erfahren Sie mehr über Expressionsvektoren
Product nameProduct name
Size / Price
Katalog: CG90429-CM
Listenpreis: 
Preis:      (You Save: )
Größe:
Menge:+-
Verfügbarkeit2-3 weeks
Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
Contact Us
Bilder
      Kürzlich angesehene Artikel
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“