After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Rhesus BTB/POZ domain-containing protein KCTD6-like Gene ORF cDNA clone expression plasmid

DatenblattBewertungenÄhnliche ProdukteProtokolle
Cynomolgus LOC701810 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:XM_001096089.1
cDNA-Größe:687bp
cDNA-Beschreibung:Full length Clone DNA of Macaca mulatta (Rhesus monkey) BTB/POZ domain-containing protein KCTD6-like.
Synonyme für Gene:LOC701810
Spezies:Rhesus
Vektor:pCMV3-untagged
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Rhesus BTB/POZ domain-containing protein KCTD6-like Gene ORF cDNA clone expression plasmid on other vectors
Rhesus BTB/POZ domain-containing protein KCTD6-like Gene ORF cDNA clone expression plasmid, C-GFPSpark tagCG90744-ACG$225
Rhesus BTB/POZ domain-containing protein KCTD6-like Gene ORF cDNA clone expression plasmid, C-OFPSpark tagCG90744-ACR$225
Rhesus BTB/POZ domain-containing protein KCTD6-like Gene ORF cDNA clone expression plasmid, N-GFPSpark tagCG90744-ANG$225
Rhesus BTB/POZ domain-containing protein KCTD6-like Gene ORF cDNA clone expression plasmid, N-OFPSpark tagCG90744-ANR$225
Rhesus BTB/POZ domain-containing protein KCTD6-like Gene ORF cDNA clone expression plasmid, C-Flag tagCG90744-CF$195
Rhesus BTB/POZ domain-containing protein KCTD6-like Gene ORF cDNA clone expression plasmid, C-His tagCG90744-CH$195
Rhesus BTB/POZ domain-containing protein KCTD6-like Gene ORF cDNA clone expression plasmid, C-Myc tagCG90744-CM$195
Rhesus BTB/POZ domain-containing protein KCTD6-like Gene ORF cDNA clone expression plasmid, C-HA tagCG90744-CY$195
Rhesus BTB/POZ domain-containing protein KCTD6-like Gene ORF cDNA clone in cloning vectorCG90744-G$75
Rhesus BTB/POZ domain-containing protein KCTD6-like Gene ORF cDNA clone expression plasmid, N-Flag tagCG90744-NF$195
Rhesus BTB/POZ domain-containing protein KCTD6-like Gene ORF cDNA clone expression plasmid, N-His tagCG90744-NH$195
Rhesus BTB/POZ domain-containing protein KCTD6-like Gene ORF cDNA clone expression plasmid, N-Myc tagCG90744-NM$195
Rhesus BTB/POZ domain-containing protein KCTD6-like Gene ORF cDNA clone expression plasmid, N-HA tagCG90744-NY$195
Rhesus BTB/POZ domain-containing protein KCTD6-like Gene ORF cDNA clone expression plasmidCG90744-UT$195
 Erfahren Sie mehr über Expressionsvektoren
Product nameProduct name
Size / Price
Katalog: CG90744-UT
Listenpreis: 
Preis:      (You Save: )
Größe:
Menge:+-
Verfügbarkeit2-3 weeks
Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
Contact Us
Bilder
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“