Schnelle Bestellung

Cynomolgus small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid

DatenblattBewertungenÄhnliche ProdukteProtokolle
Cynomolgus LOC102130101 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_001284821.1
cDNA-Größe:306bp
cDNA-Beschreibung:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) small ubiquitin-related modifier 1-like.
Synonyme für Gene:LOC102130101
Spezies:Cynomolgus
Vektor:pCMV3-untagged
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Cynomolgus small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid on other vectors
Cynomolgus small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid, C-GFPSpark tagCG90733-ACG$325
Cynomolgus small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid, C-OFPSpark tagCG90733-ACR$325
Cynomolgus small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid, N-GFPSpark tagCG90733-ANG$325
Cynomolgus small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid, N-OFPSpark tagCG90733-ANR$325
Cynomolgus small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid, C-Flag tagCG90733-CF$295
Cynomolgus small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid, C-His tagCG90733-CH$295
Cynomolgus small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid, C-Myc tagCG90733-CM$295
Cynomolgus small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid, C-HA tagCG90733-CY$295
Cynomolgus small ubiquitin-related modifier 1-like Gene ORF cDNA clone in cloning vectorCG90733-G$75
Cynomolgus small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid, N-Flag tagCG90733-NF$295
Cynomolgus small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid, N-His tagCG90733-NH$295
Cynomolgus small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid, N-Myc tagCG90733-NM$295
Cynomolgus small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid, N-HA tagCG90733-NY$295
Cynomolgus small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmidCG90733-UT$295
 Erfahren Sie mehr über Expressionsvektoren
Product nameProduct name
Size / Price
Katalog: CG90733-UT
Listenpreis: 
Preis:      (You Save: )
Contact Us
Bilder
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“