After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

Cynomolgus small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid

DatenblattBewertungenÄhnliche ProdukteProtokolle
Cynomolgus LOC102130101 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_001284821.1
cDNA-Größe:306bp
cDNA-Beschreibung:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) small ubiquitin-related modifier 1-like.
Synonyme für Gene:LOC102130101
Spezies:Cynomolgus
Vektor:pCMV3-untagged
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Cynomolgus small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid on other vectors
Cynomolgus small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid, C-GFPSpark tagCG90733-ACG$225
Cynomolgus small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid, C-OFPSpark tagCG90733-ACR$225
Cynomolgus small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid, N-GFPSpark tagCG90733-ANG$225
Cynomolgus small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid, N-OFPSpark tagCG90733-ANR$225
Cynomolgus small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid, C-Flag tagCG90733-CF$195
Cynomolgus small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid, C-His tagCG90733-CH$195
Cynomolgus small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid, C-Myc tagCG90733-CM$195
Cynomolgus small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid, C-HA tagCG90733-CY$195
Cynomolgus small ubiquitin-related modifier 1-like Gene ORF cDNA clone in cloning vectorCG90733-G$75
Cynomolgus small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid, N-Flag tagCG90733-NF$195
Cynomolgus small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid, N-His tagCG90733-NH$195
Cynomolgus small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid, N-Myc tagCG90733-NM$195
Cynomolgus small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmid, N-HA tagCG90733-NY$195
Cynomolgus small ubiquitin-related modifier 1-like Gene ORF cDNA clone expression plasmidCG90733-UT$195
 Erfahren Sie mehr über Expressionsvektoren
Product nameProduct name
Size / Price
Katalog: CG90733-UT
Listenpreis: 
Preis:      (You Save: )
Größe:
Menge:+-
Verfügbarkeit2-3 weeks
Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
Contact Us
Bilder
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“