After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

Cynomolgus IGSF8 Gene ORF cDNA clone expression plasmid

DatenblattBewertungenÄhnliche ProdukteProtokolle
Cynomolgus IGSF8 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:XM_005541281.1
cDNA-Größe:1845bp
cDNA-Beschreibung:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) immunoglobulin superfamily, member 8.
Synonyme für Gene:IGSF8
Spezies:Cynomolgus
Vektor:pCMV3-untagged
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Referenzen
  • Glazar AI, et al. (2009) Immunoglobulin superfamily member IgSF8 (EWI-2) and CD9 in fertilisation: evidence of distinct functions for CD9 and a CD9-associated protein in mammalian sperm-egg interaction. Reprod Fertil Dev. 21(2): 293-303.
  • Murdoch JN, et al. (2003) Genomic organization and embryonic expression of Igsf8, an immunoglobulin superfamily member implicated in development of the nervous system and organ epithelia. Mol Cell Neurosci. 22(1): 62-74.
  • Zhang XA, et al. (2003) EWI2/PGRL associates with the metastasis suppressor KAI1/CD82 and inhibits the migration of prostate cancer cells. Cancer Res. 63 (10): 2665-74.
  • Size / Price
    Katalog: CG90732-UT
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    Verfügbarkeit2-3 weeks
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    Bilder
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“