After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Rhesus ENO1 / Enolase 1 / alpha-enolase Gene ORF cDNA clone expression plasmid, C-His tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Cynomolgus ENO1 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:NM_001195611.1
cDNA-Größe:1305bp
cDNA-Beschreibung:Full length Clone DNA of Macaca mulatta (Rhesus monkey) enolase 1, (alpha) with C terminal His tag.
Synonyme für Gene:ENO1
Spezies:Rhesus
Vektor:pCMV3-C-His
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Rhesus ENO1 / Enolase 1 / alpha-enolase Gene ORF cDNA clone expression plasmid, C-His tag on other vectors
Product nameProduct name
Referenzen
  • Capello M, et al. (2011) a-Enolase: a promising therapeutic and diagnostic tumor target. FEBS J. 278(7): 1064-74.
  • Kang HJ, et al. (2008) Structure of human alpha-enolase (hENO1), a multifunctional glycolytic enzyme. Acta Crystallogr D Biol Crystallogr. 64(Pt 6): 651-7.
  • Lopez-Alemany R, et al. (2005) Alpha-enolase plasminogen receptor in myogenesis. Front Biosci. 10: 30-6.
  • Ejeskdr K, et al. (2005) Introduction of in vitro transcribed ENO1 mRNA into neuroblastoma cells induces cell death. BMC Cancer. 5: 161.
  • Size / Price
    Katalog: CG90355-CH
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    Verfügbarkeit2-3 weeks
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    Bilder
        Kürzlich angesehene Artikel
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“