Chymotrypsin C cDNA ORF Clone, Rhesus, N-Myc tag

Cat: CG90522-NM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All Chymotrypsin C Reagents

CRO Services

Product recommended


All Chymotrypsin C Reagents

Chymotrypsin C cDNA ORF Clone, Rhesus, N-Myc tag General Information

Gene

Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
807 bp
Description
Full length Clone DNA of Rhesus chymotrypsin C (caldecrin) with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Chymotrypsin C Background Information

Chymotrypsin C (abbreviated for CTRC), also known as caldecrin or elastase4, is a digestive enzyme of the peptidase S1 family. This enzyme is synthesized as an inactivate chymotrypsinogen. On cleavage by trypsin into two parts that activate each other by removing two small peptides in a trans-proteolysis, chymotrypsin C produced. N-linked glycosylation of human CTRC is required for efficient folding and secretion, however, the N-linked glycan is unimportant for enzyme activity or inhibitor binding. It has been proposed that CTRC is a key regulator of digestive zymogen activation and a physiological co-activator of digestive carboxypeptidases proCPA1 and proCPA2. Mutations that abolish activity or secretion of CTRC increase the risk for chronic pancreatitis. It's speculated that CTRC might regulate pancreatic cancer cell migration in relation to cytokeratin 18 expression. The pancreatic cancer cell migration ability was downregulated in pancreatic cancer Aspc-1 cells that overexpressed CTRC, whereas the cell migration ability was upregulated in Aspc-1 cells in which CTRC was suppressed. 

Full Name
chymotrypsin C (caldecrin)
References
  • Lacruz RS, et al. (2011) Chymotrypsin C (caldecrin) is associated with enamel development. J Dent Res. 90 (10): 1228-33.
  • Zhou J, et al. (2011) Chymotrypsin C mutations in chronic pancreatitis. J Gastroenterol Hepatol. 26 (8): 1238-46.
  • Wang H, et al. (2011) Effect of chymotrypsin C and related proteins on pancreatic cancer cell migration. Acta Biochim Biophys Sin (Shanghai). 43 (5): 362-71.
  • Chymotrypsin C cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    Chymotrypsin C cDNA ORF Clone in Cloning Vector, Rhesus CG90522-U
    Chymotrypsin C cDNA ORF Clone, Rhesus, untagged CG90522-UT
    Chymotrypsin C cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90522-ACG
    Chymotrypsin C Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90522-ACGLN
    Chymotrypsin C cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90522-ANG
    Chymotrypsin C cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90522-ACR
    Chymotrypsin C cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90522-ANR
    Chymotrypsin C cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90522-CF
    Chymotrypsin C cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90522-NF
    Chymotrypsin C cDNA ORF Clone, Rhesus, C-His tag CG90522-CH
    Chymotrypsin C cDNA ORF Clone, Rhesus, N-His tag CG90522-NH
    Chymotrypsin C cDNA ORF Clone, Rhesus, C-HA tag CG90522-CY
    Chymotrypsin C cDNA ORF Clone, Rhesus, N-HA tag CG90522-NY
    Chymotrypsin C cDNA ORF Clone, Rhesus, C-Myc tag CG90522-CM

    Chymotrypsin C cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Chymotrypsin C cDNA ORF Clone in Cloning Vector, Mouse MG5A4039-U
    Chymotrypsin C cDNA ORF Clone, Mouse, untagged MG5A4039-UT
    Chymotrypsin C Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A4039-ACGLN
    Chymotrypsin C cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A4039-ACG
    Chymotrypsin C cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A4039-ACR
    Chymotrypsin C cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A4039-CF
    Chymotrypsin C cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A4039-NF
    Chymotrypsin C cDNA ORF Clone, Mouse, C-His tag MG5A4039-CH
    Chymotrypsin C cDNA ORF Clone, Mouse, N-His tag MG5A4039-NH
    Chymotrypsin C cDNA ORF Clone, Mouse, C-HA tag MG5A4039-CY
    Chymotrypsin C cDNA ORF Clone, Mouse, N-HA tag MG5A4039-NY
    Chymotrypsin C cDNA ORF Clone, Mouse, C-Myc tag MG5A4039-CM
    Chymotrypsin C cDNA ORF Clone, Mouse, N-Myc tag MG5A4039-NM

    Chymotrypsin C cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Chymotrypsin C cDNA ORF Clone in Cloning Vector, Human HG11456-M
    Chymotrypsin C cDNA ORF Clone, Human, untagged HG11456-UT
    Chymotrypsin C cDNA ORF Clone, Human, C-GFPSpark® tag HG11456-ACG
    Chymotrypsin C Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11456-ACGLN
    Chymotrypsin C cDNA ORF Clone, Human, N-GFPSpark® tag HG11456-ANG
    Chymotrypsin C cDNA ORF Clone, Human, C-OFPSpark® tag HG11456-ACR
    Chymotrypsin C cDNA ORF Clone, Human, N-OFPSpark® tag HG11456-ANR
    Chymotrypsin C cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11456-CF
    Chymotrypsin C cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11456-NF
    Chymotrypsin C cDNA ORF Clone, Human, C-His tag HG11456-CH
    Chymotrypsin C cDNA ORF Clone, Human, N-His tag HG11456-NH
    Chymotrypsin C cDNA ORF Clone, Human, C-HA tag HG11456-CY
    Chymotrypsin C cDNA ORF Clone, Human, N-HA tag HG11456-NY
    Chymotrypsin C cDNA ORF Clone, Human, C-Myc tag HG11456-CM
    Chymotrypsin C cDNA ORF Clone, Human, N-Myc tag HG11456-NM
    Chymotrypsin C qPCR Primer Pairs, Human HP101333
    info info
    添加购物车成功! 添加购物车失败!