Schnelle Bestellung

Cynomolgus CHN1 / chimerin 1 Gene ORF cDNA clone expression plasmid, C-HA tag

    DatenblattBewertungenÄhnliche ProdukteProtokolle
    Cynomolgus CHN1 Produktinformation zum cDNA-Klon
    Gene_bank_ref_id:AB173631.1
    cDNA-Größe:1005bp
    cDNA-Beschreibung:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) chimerin 1 with C terminal HA tag.
    Synonyme für Gene:CHN1
    Spezies:Cynomolgus
    Vektor:pCMV3-C-HA
    Plasmid:
    Restriktionsschnittstelle:
    Tag-Sequenz:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Sequenzbeschreibung:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Product nameProduct name
    Hintergrund

    CHN1, also known as chimerin 1, is a TPase-activating protein for ras-related p21-rac and a phorbol ester receptor. It is predominantly expressed in neurons, and plays an important role in neuronal signal-transduction mechanisms. CHN1 is involved in the assembly of neuronal locomotor circuits as a direct effector of EPHA4 in axon guidance. The CHN1 gene provides instructions for making two very similar proteins called α1-chimaerin and α2-chimaerin. These proteins play an important role in the early development of the nervous system. In particular, they help regulate complex chemical signaling pathways during the formation and development of nerve cells (neurons). These proteins help guide the growth of axons and dendrites, which are specialized extensions of neurons that transmit and receive nerve impulses throughout the nervous system.

    Referenzen
  • Miyake N. et al, 2010, Am J Med Genet A. 152 (1): 215-7.
  • Miyake N. et al., 2011, Invest Ophthalmol Vis Sci. 52 (9): 6321-8.
  • Volk AE. et al., 2010, Graefes Arch Clin Exp Ophthalmol. 248 (9): 1351-7.
  • Size / Price
    Katalog: CG90836-CY
    Listenpreis: 
    Preis:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Kürzlich angesehene Artikel
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“