B3GNT1 cDNA ORF Clone, Cynomolgus, N-HA tag

Cat: CG90818-NY

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All B3GNT1 Reagents

CRO Services

Product recommended


All B3GNT1 Reagents

B3GNT1 cDNA ORF Clone, Cynomolgus, N-HA tag General Information

Gene

Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
1248 bp
Description
Full length Clone DNA of Cynomolgus UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1 with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

B3GNT1 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
B3GNT1 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90818-G
B3GNT1 cDNA ORF Clone, Cynomolgus, untagged CG90818-UT
B3GNT1 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90818-ACGLN
B3GNT1 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90818-ACG
B3GNT1 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90818-ACR
B3GNT1 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90818-CF
B3GNT1 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90818-NF
B3GNT1 cDNA ORF Clone, Cynomolgus, C-His tag CG90818-CH
B3GNT1 cDNA ORF Clone, Cynomolgus, N-His tag CG90818-NH
B3GNT1 cDNA ORF Clone, Cynomolgus, C-HA tag CG90818-CY
B3GNT1 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90818-CM
B3GNT1 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90818-NM

B3GNT1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
B3GNT1 cDNA ORF Clone in Cloning Vector, Mouse MG51664-G
B3GNT1 cDNA ORF Clone, Mouse, untagged MG51664-UT
B3GNT1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51664-ACGLN
B3GNT1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51664-ACG
B3GNT1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51664-ACR
B3GNT1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51664-CF
B3GNT1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51664-NF
B3GNT1 cDNA ORF Clone, Mouse, C-His tag MG51664-CH
B3GNT1 cDNA ORF Clone, Mouse, N-His tag MG51664-NH
B3GNT1 cDNA ORF Clone, Mouse, C-HA tag MG51664-CY
B3GNT1 cDNA ORF Clone, Mouse, N-HA tag MG51664-NY
B3GNT1 cDNA ORF Clone, Mouse, C-Myc tag MG51664-CM
B3GNT1 cDNA ORF Clone, Mouse, N-Myc tag MG51664-NM
B3GNT1 qPCR Primer Pairs, Mouse MP201537

B3GNT1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
B3GNT1 cDNA ORF Clone in Cloning Vector, Human HG17091-U
B3GNT1 cDNA ORF Clone in Cloning Vector, Human HG14779-G
B3GNT1 cDNA ORF Clone, Human, untagged HG17091-UT
B3GNT1 cDNA ORF Clone, Human, untagged HG14779-UT
B3GNT1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14779-ACGLN
B3GNT1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17091-ACGLN
B3GNT1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14779-ACG
B3GNT1 cDNA ORF Clone, Human, C-GFPSpark® tag HG17091-ACG
B3GNT1 cDNA ORF Clone, Human, N-GFPSpark® tag HG17091-ANG
B3GNT1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14779-ACR
B3GNT1 cDNA ORF Clone, Human, C-OFPSpark® tag HG17091-ACR
B3GNT1 cDNA ORF Clone, Human, N-OFPSpark® tag HG17091-ANR
B3GNT1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17091-CF
B3GNT1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14779-CF
B3GNT1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17091-NF
B3GNT1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14779-NF
B3GNT1 cDNA ORF Clone, Human, C-His tag HG17091-CH
B3GNT1 cDNA ORF Clone, Human, C-His tag HG14779-CH
B3GNT1 cDNA ORF Clone, Human, N-His tag HG14779-NH
B3GNT1 cDNA ORF Clone, Human, N-His tag HG17091-NH
B3GNT1 cDNA ORF Clone, Human, C-HA tag HG14779-CY
B3GNT1 cDNA ORF Clone, Human, C-HA tag HG17091-CY
B3GNT1 cDNA ORF Clone, Human, N-HA tag HG17091-NY
B3GNT1 cDNA ORF Clone, Human, N-HA tag HG14779-NY
B3GNT1 cDNA ORF Clone, Human, C-Myc tag HG17091-CM
B3GNT1 cDNA ORF Clone, Human, C-Myc tag HG14779-CM
B3GNT1 cDNA ORF Clone, Human, N-Myc tag HG14779-NM
B3GNT1 cDNA ORF Clone, Human, N-Myc tag HG17091-NM
B3GNT1 qPCR Primer Pairs, Human HP103412
info info
添加购物车成功! 添加购物车失败!