After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

Cynomolgus ARF3 / ADP-ribosylation factor 3 Gene ORF cDNA clone expression plasmid

DatenblattBewertungenÄhnliche ProdukteProtokolle
Cynomolgus ARF3 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:XM_005570735.1
cDNA-Größe:546bp
cDNA-Beschreibung:Full length Clone DNA of Macaca fascicularis (Crab-eating macaque) (Cynomolgus monkey) ADP-ribosylation factor 3.
Synonyme für Gene:ARF3
Spezies:Cynomolgus
Vektor:pCMV3-untagged
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Hintergrund

ARF3, also known as ADP-ribosylation factor 3, belongs to the RAS superfamily. Members of this family include ARF1, ARF2, ARF3, ARF4, ARF5 and ARF6. ARF3 gene is a member of the human ARF gene family. These genes encode small guanine nucleotide-binding proteins that stimulate the ADP-ribosyltransferase activity of cholera toxin and play a role in vesicular trafficking and as activators of phospholipase D. ARF3 functions as an allosteric activator of the cholera toxin subunit, an ADP-ribosyltransferase. It is involved in protein trafficking and may modulate vesicle budding and uncoating within the Golgi apparatus.

Referenzen
  • Hirai M. et al., 1997, Genomics. 34 (2): 263-5.
  • Kanoh H. et al., 1997, J Biol Chem. 272 (9): 5421-9.
  • Boman. et al., 2002, Mol Biol Cell. 13 (9): 3078-95.
  • Size / Price
    Katalog: CG90751-UT
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    Verfügbarkeit2-3 weeks
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    Bilder
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“