RBP4 cDNA ORF Clone, Canine, C-DDK (Flag®) tag

Price:
Size:
Number:

RBP4 cDNA ORF Clone, Canine, C-DDK (Flag®) tag: General Information

Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
606 bp
Description
Full length Clone DNA of Canine retinol binding protein 4, plasma with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

RBP4 Background Information

Retinol-binding protein 4 (RBP4) is the specific carrier for retinol (also known as vitamin A), and is responsible for the conversion of unstable and insoluble retinol in aqueous solution into stable and soluble complex in plasma through their tight interaction. As a member of the lipocalin superfamily, RBP4 containing a β-barrel structure with a well-defined cavity is secreted from the liver, and in turn delivers retinol from the liver stores to the peripheral tissues. In plasma, the RBP4-retinol complex interacts with transthyretin (TTR), and this binding is crucial for preventing RBP4 excretion through the kidney glomeruli. RBP4 expressed from an ectopic source efficiently delivers retinol to the eyes, and its deficiency affects night vision largely. Recently, RBP4 as an adipokine, is found to be expressed in adipose tissue and correlated with obesity, insulin resistance (IR) and type 2 diabetes (T2DM).
Full Name
retinol binding protein 4, plasma
References
  • Yang Q, et al. (2005) Serum retinol binding protein 4 contributes to insulin resistance in obesity and type 2 diabetes. Nature. 436(7049): 356-62.
  • Choi SH, et al. (2008) High plasma retinol binding protein-4 and low plasma adiponectin concentrations are associated with severity of glucose intolerance in women with previous gestational diabetes mellitus. J Clin Endocrinol Metab. 93(8): 3142-8.
  • Tepper BJ, et al. (2010) Serum retinol-binding protein 4 (RBP4) and retinol in a cohort of borderline obese women with and without gestational diabetes. Clin Biochem. 43(3): 320-3.
Add to Cart Successfully Add to Cart Failed