Schnelle Bestellung

Canine NME1 ORF mammalian expression plasmid, C-His tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Kynologisch NME1 Produktinformation zum cDNA-Klon
Gene_bank_ref_id:XM_005624340.1
cDNA-Größe:459bp
cDNA-Beschreibung:Full length Clone DNA of Canis lupus familiaris non-metastatic cells 1, protein (NM23A) expressed in with C terminal His tag.
Synonyme für Gene:NM23A, NM23-C1
Spezies:Canine
Vektor:pCMV3-C-His
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Hintergrund

NME1, also known as Nucleoside Diphosphate Kinase A (NDK-A), or NM23-H1, belongs to the NDK family. NM23-H1 is known to have a metastasis suppressive activity in many tumor cells. Recent studies have shown that the interacting proteins with NM23-H1 which mediate the cell proliferation, may act as modulators of the metastasis suppressor activity. The interacting proteins with NM23-H1 can be classified into 3 groups. The first group of proteins can be classified as upstream kinases of NM23-H1 such as CKI and Aurora-A/STK15. The second group of proteins acts as downstream effectors for the regulation of specific gene transcriptions, GTP-binding protein functions, and signal transduction in Erk signal cascade. The third group of proteins can be classified as bi-directionally influencing binding partners of NM23-H1. As a result, the interactions with NM23-H1 and binding partners have implications in the biochemical characterization involved in metastasis and tumorigenesis. NDKA is increased in human postmortem cerebrospinal fluid (CSF), a model of global brain insult, suggesting that measurement in CSF and, more importantly, in plasma may be useful as a biomarker of stroke. Additionally, NM23-H1 significantly reduces metastasis without effects on primary tumor size and was the first discovered metastasis suppressor gene.

Referenzen
  • Allard L, et al. (2005) PARK7 and nucleoside diphosphate kinase A as plasma markers for the early diagnosis of stroke. Clin Chem. 51(11): 2043-51.
  • Steeg PS, et al. (2008) Clinical-translational approaches to the Nm23-H1 metastasis suppressor. Clin Cancer Res. 14(16): 5006-12.
  • Kim HD, et al. (2009) Regulators affecting the metastasis suppressor activity of Nm23-H1. Mol Cell Biochem. 329(1-2): 167-73.
  • Size / Price
    Katalog: DG70213-CH
    Listenpreis:   (Save )
    Preis:      [How to order]
    Verfügbarkeit
     Anweisungen für die Lieferung
    Bilder
        Kürzlich angesehene Artikel
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“