After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Schnelle Bestellung

Text Size:AAA

Kynologisch LC3B / MAP1LC3B Gene ORF cDNA clone expression plasmid, C-His tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Kynologisch MAP1LC3B Produktinformation zum cDNA-Klon
Gene_bank_ref_id:XM_536756.4
cDNA-Größe:378bp
cDNA-Beschreibung:Full length Clone DNA of Canis lupus familiaris microtubule-associated protein 1 light chain 3 beta with C terminal His tag.
Synonyme für Gene:MAP1LC3B
Spezies:Canine
Vektor:pCMV3-C-His
Plasmid:
Restriktionsschnittstelle:
Tag-Sequenz:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequenzbeschreibung:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Hintergrund

LC3B, also known as MAP1LC3B, is a member of the MAP1 LC3 family. It is moat abundantly expressed in heart, brain, skeletal muscle and testis. LC3B is a subunit of neuronal microtubule and functions in formation of autophagosomal vacuoles (autophagosomes). It associated MAP1A and MAP1B proteins, which are involved in microtubule assembly and important for neurogenesis. LC3B also plays a role in autophagy, a process that involves the bulk degradation of cytoplasmic component.

Referenzen
  • Behrends C. et al., 2010, Nature. 466 (7302): 68-76.
  • Tanida I. et al., 2005, Int J Biochem Cell Biol. 36 (12): 2503-18.
  • Kabeya Y. et al., 2000, EMBO J. 19 (21): 5720-8.
  • Cherra SJ. et al., 2010, J Cell Biol. 190 (4): 533-9.
  • Size / Price
    Katalog: DG70200-CH
    Listenpreis: 
    Preis:      (You Save: )
    Größe:
    Menge:+-
    Verfügbarkeit2-3 weeks
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    Bilder
        Kürzlich angesehene Artikel
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Bitte beachten: Alle Produkte sind „FÜR FORSCHUNGSZWECKE VORGESEHEN UND DÜRFEN NICHT ZUR DIAGNOSE ODER THERAPIE VERWENDET WERDEN“