IL13RA2 cDNA ORF Clone, Canine, C-Myc tag

Cat: DG70079-CM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All IL13RA2 Reagents

CRO Services

Product recommended


All IL13RA2 Reagents

IL13RA2 cDNA ORF Clone, Canine, C-Myc tag General Information

Gene

Species
Canine
NCBI Ref Seq
RefSeq ORF Size
1161 bp
Description
Full length Clone DNA of Canine interleukin 13 receptor, alpha 2 with C terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL13RA2 Background Information

Interleukin-13 receptor subunit alpha-2 (IL13RA2/IL-13RA2) is also known as also known as cluster of differentiation 213A2 (CD213A2), IL-13 receptor subunit alpha-2, IL-13R subunit alpha-2, and IL-13RA2. The IL13RA2 is often overexpressed in brain tumors, making Il13ra2 one of the vaccine targets for immunotherapy of glioma. IL13RA2/IL-13RA2 is a cancer-associated receptor that is present in greater than 80% of High Grade Astrocytomas (HGA) and has recently been recognized as a cytokine that predisposes breast cancer cells to metastasize. Expression of IL13Rα2 was rapidly lost from the surface of transduced cells grown in culture. The loss appeared to be related to ligands present in fetal bovine serum in the medium. None of the malignant glioma cell lines cultivated in vitro and tested to date exhibited the IL13Rα2 receptor. A recombinant virus (R5111) enters cells via its interaction with the IL13Rα2 receptor in a manner that cannot be differentiated from the interaction of wild-type virus with its receptors.

Full Name
interleukin 13 receptor, alpha 2
References
  • Zhou G, et al.. (2005) Characterization of a recombinant herpes simplex virus 1 designed to enter cells via the IL13Ralpha2 receptor of malignant glioma cells. J Virol. 79(9): 5272-7.
  • Osawa M, et al.. (2000) Characterization of the mouse interleukin-13 receptor alpha1 gene. Immunogenetics. 51(11): 974-81.
  • Nair BG, et al.. (2011) Nanotechnology platforms; an innovative approach to brain tumor therapy. Med Chem. 7(5): 488-503.
  • Benson M, et al.. (2006) A network-based analysis of the late-phase reaction of the skin. J Allergy Clin Immunol. 118(1): 220-5.
  • IL13RA2 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    IL13RA2 cDNA ORF Clone in Cloning Vector, Canine DG70079-G
    IL13RA2 cDNA ORF Clone, Canine, untagged DG70079-UT
    IL13RA2 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70079-ACG
    IL13RA2 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70079-ACGLN
    IL13RA2 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70079-ACR
    IL13RA2 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70079-CF
    IL13RA2 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70079-NF
    IL13RA2 cDNA ORF Clone, Canine, C-His tag DG70079-CH
    IL13RA2 cDNA ORF Clone, Canine, N-His tag DG70079-NH
    IL13RA2 cDNA ORF Clone, Canine, C-HA tag DG70079-CY
    IL13RA2 cDNA ORF Clone, Canine, N-HA tag DG70079-NY
    IL13RA2 cDNA ORF Clone, Canine, N-Myc tag DG70079-NM

    IL13RA2 cDNA ORF Clone, Cynomolgus, Related Products

    Product Name Catalog#(PDF)
    IL13RA2 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90855-G

    IL13RA2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    IL13RA2 cDNA ORF Clone in Cloning Vector, Rat RG80204-G
    IL13RA2 cDNA ORF Clone, Rat, untagged RG80204-UT
    IL13RA2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80204-ACGLN
    IL13RA2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80204-ACG
    IL13RA2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80204-ACR
    IL13RA2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80204-CF
    IL13RA2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80204-NF
    IL13RA2 cDNA ORF Clone, Rat, C-His tag RG80204-CH
    IL13RA2 cDNA ORF Clone, Rat, N-His tag RG80204-NH
    IL13RA2 cDNA ORF Clone, Rat, C-HA tag RG80204-CY
    IL13RA2 cDNA ORF Clone, Rat, N-HA tag RG80204-NY
    IL13RA2 cDNA ORF Clone, Rat, C-Myc tag RG80204-CM
    IL13RA2 cDNA ORF Clone, Rat, N-Myc tag RG80204-NM
    IL13RA2 qPCR Primer Pairs, Rat RP300196

    IL13RA2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IL13RA2 cDNA ORF Clone in Cloning Vector, Mouse MG50061-M
    IL13RA2 cDNA ORF Clone, Mouse, untagged MG50061-UT
    IL13RA2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50061-ACGLN
    IL13RA2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50061-ACG
    IL13RA2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50061-ACR
    IL13RA2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50061-CF
    IL13RA2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50061-NF
    IL13RA2 cDNA ORF Clone, Mouse, C-His tag MG50061-CH
    IL13RA2 cDNA ORF Clone, Mouse, N-His tag MG50061-NH
    IL13RA2 cDNA ORF Clone, Mouse, C-HA tag MG50061-CY
    IL13RA2 cDNA ORF Clone, Mouse, N-HA tag MG50061-NY
    IL13RA2 cDNA ORF Clone, Mouse, C-Myc tag MG50061-CM
    IL13RA2 cDNA ORF Clone, Mouse, N-Myc tag MG50061-NM
    IL13RA2 qPCR Primer Pairs, Mouse MP200061

    IL13RA2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IL13RA2 cDNA ORF Clone in Cloning Vector, Human HG10350-M
    IL13RA2 cDNA ORF Clone, Human, untagged HG10350-UT
    IL13RA2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10350-ACGLN
    IL13RA2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10350-ACG
    IL13RA2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10350-ACR
    IL13RA2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10350-CF
    IL13RA2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10350-NF
    IL13RA2 cDNA ORF Clone, Human, C-His tag HG10350-CH
    IL13RA2 cDNA ORF Clone, Human, N-His tag HG10350-NH
    IL13RA2 cDNA ORF Clone, Human, C-HA tag HG10350-CY
    IL13RA2 cDNA ORF Clone, Human, N-HA tag HG10350-NY
    IL13RA2 cDNA ORF Clone, Human, C-Myc tag HG10350-CM
    IL13RA2 cDNA ORF Clone, Human, N-Myc tag HG10350-NM
    IL13RA2 qPCR Primer Pairs, Human HP100387
    info info
    添加购物车成功! 添加购物车失败!