CCL5 cDNA ORF Clone, Canine, C-DDK (Flag®) tag

Price:
Size:
Number:

CCL5 cDNA ORF Clone, Canine, C-DDK (Flag®) tag: General Information

Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
276 bp
Description
Full length Clone DNA of Canine chemokine (C-C motif) ligand 5 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CCL5 Background Information

Chemokines are a family of small chemotactic cytokines, or proteins secreted by cells. Chemokines share the same structure similarities such as small size, and the presence of four cysteine residues in conserved locations in order to form their 3-dimensional shape. Some of the chemokines are considered pro-inflammatory which can be induced to recruit cells of the immune system to a site of infection during an immune response, while others are considered homeostatic and are implied in controlling the migration of cells during normal processes of tissue maintenance and development. There are four members of the chemokine family: C-C kemokines, C kemokines, CXC kemokines and CX3C kemokines. The C-C kemokines have two cysteines nearby the amino terminus. There have been at least 27 distinct members of this subgroup reported for mammals, called C-C chemokine ligands-1 to 28. Chemokin ligand 5(CCL5) is chemotactic for T cells, basophils and eosinophils. Chemokin ligand 5(CCL5) has been considered a HIV-supressor secreted by CD8+ T cells and other immune cells. Chemokin ligand 5(CCL5) is a key to activating recruit leukocytes into inflammatory sites and in the presence of particular cytokines released by T cells, it can change the NK cells into CHAK cells.
Full Name
chemokine (C-C motif) ligand 5
References
  • Laing KJ, et al. (2004) Chemokines. Developmental and comparative immunology. 28(5): 443-60.
  • Cocchi F, et al. (1995) Identification of RANTES, MIP-1a, and MIP-1b as the major HIV-suppressive factor produced by CD8+ T cells. Science. 270 (5243): 1811-5.
  • Vangelista L, et al. (2010) Engineering of Lactobacillus jensenii to secrete RANTES and a CCR5 antagonist analogue as live HIV-1 blockers. Antimicrob. Agents Chemother. 54 (7): 2994-3001.
  • Maghazachi AA, et al. (1996) CC chemokines induce the generation of killer cells from CD56+ cells. Eur. J. Immunol. 26 (2): 315-9.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait