Schnelle Bestellung

Text Size:AAA

Maus CXCL5 Gene ORF cDNA clone expression plasmid, C-His tag

DatenblattBewertungenÄhnliche ProdukteProtokolle
Mouse CXCL5 Produktinformation zum cDNA-Klon
cDNA-Beschreibung:Full length Clone DNA of Mus musculus chemokine (C-X-C motif) ligand 5 with His tag.
Synonyme für Gene:LIX, GCP-2, Scyb5, Scyb6, ENA-78, AMCF-II, Cxcl5
Restriktionsschnittstelle:KpnI + XhoI (5.5kb + 0.43kb)
Sequenzbeschreibung:Identical with the Gene Bank Ref.ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Lagerung:The lyophilized plasmid can be stored at room temperature for three months.
Mouse CXCL5 Gene Plasmid Map
Mouse CXCL5 Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged
pCMV/hygro-HIs Vector Information
Vector Name pCMV/hygro-His
Vector Size 5687bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name

CXCL5 is a small cytokine belonging to the CXC chemokine family. CXC chemokines are particularly significant for leukocyte infiltration in inflammatory diseases. CXCL5 is produced following stimulation of cells with the inflammatory cytokines interleukin-1 or tumor necrosis factor-alpha. It also can be detected in eosinophils, and can be inhibited with the type II interferon. CXCL5 plays a role in reducing sensitivity to sunburn pain in some subjects, and is a potential target which can be utilized to understand more about pain in other inflammatory conditions like arthritis and cystitis. It stimulates the chemotaxis of neutrophils possesses angiogenic properties. It elicits these effects by interacting with the cell surface chemokine receptor CXCR2.

  • Dawes JM, et al. (2011) CXCL5 Mediates UVB Irradiation-Induced Pain. Sci Transl Med. 3(90): 90ra60.
  • O'Donovan N, et al. (1999) Physical mapping of the CXC chemokine locus on human chromosome 4. Cytogenet. Cell Genet. 84(1-2):39-42.
  • Persson T, et al. (2003) Expression of the neutrophil-activating CXC chemokine ENA-78/CXCL5 by human eosinophils. Clin Exp Allergy. 33(4):531-7.
  • Size / Price
    Katalog: MG50354-M-H
    Preis:      (You Save: )
    VerfügbarkeitIn Stock
    Anfrage zu GroßauftragZum Einkaufswagen hinzufügen
    Contact Us
    • Mouse CXCL5 Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged
      Kürzlich angesehene Artikel
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.