BRDT cDNA ORF Clone, Human, untagged

Cat: HG11602-M-N

This product is not available, please contact order@sinobiological.com for relevant product if required.

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All BRDT Reagents

CRO Services


All BRDT Reagents

BRDT cDNA ORF Clone, Human, untagged General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
2844 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for two mutations 9 G/T and 2611 T/C not causing the amino acid variation.
Description
Full length Clone DNA of Human bromodomain, testis-specific.

Plasmid

Promoter
Enhanced CMV promoter
Vector
pCMV/hygro
Restriction Sites
NheI + XhoI (5.5kb + 2.84kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

BRDT cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

BRDT cDNA ORF Clone, Human, untagged Validated Images

Human MMP-3 Gene Plasmid Map 7156

BRDT cDNA ORF Clone, Human, untagged Alternative Names

BRD6 cDNA ORF Clone, Human;CT9 cDNA ORF Clone, Human

BRDT Background Information

The BRDT gene and its transcripts (bromodomain testis-specific gene, also referred to as FSRG3 or BRD6) represent potential candidates for studying the role of epigenetic changes for fertility and paternal contribution to the embryo, as they play an important role in the establishment of proper germ cell differentiation. The first bromodomain of the BRDT protein recognises the acetylation marks of histone 4 in order to start chromatin remodelling. In addition, male mice carrying a mutation within the allele of the first bromodomain are subfertile. BRDT transcripts have been demonstrated to be specifically expressed in human and murine testis. In the latter, Brdt mRNA has been observed from pachytene spermatocytes to spermatids. In man, a splicing variant of the BRDT gene (BRDT-NY) was found in embryonic and adult human testis and spermatozoa from fertile men. By contrast, transcripts of this splicing variant could not be detected in testis of some azoospermic men including arrest of spermatogenesis at the level of round spermatids. As spermatozoa are known to contain a variety of transcripts and mRNAs could be delivered from sperm to oocyte, it might be possible that BRDT mRNA influences chromatin compaction during spermiogenesis and/or expression of BRDT during early embryogenesis.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
bromodomain, testis-specific
References
  • Steilmann C, Cavalcanti M C O, Bartkuhn M, et al. The interaction of modified histones with the bromodomain testis-specific (BRDT) gene and its mRNA level in sperm of fertile donors and subfertile men[J]. Reproduction, 2010, 140(3): 435-443.
  • info info
    添加购物车成功! 添加购物车失败!