B Raf cDNA ORF Clone, Human, C-His tag

1/1

This product is not available, please contact order_us@sinobiological.com for relevant product if required.

B Raf cDNA ORF Clone, Human, C-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2301 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutation 6 G/T and 2295 C/A not causing the amino acid variation.
Description
Full length Clone DNA of Human v-raf murine sarcoma viral oncogene homolog B1 with His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro-His
Restriction Sites
HindIII + XbaI (5.5kb + 2.33kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

B Raf cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

B Raf cDNA ORF Clone, Human, C-His tag: Validated Images

B Raf cDNA ORF Clone, Human, C-His tag: Alternative Names

B-RAF1 cDNA ORF Clone, Human; BRAF1 cDNA ORF Clone, Human; NS7 cDNA ORF Clone, Human; RAFB1 cDNA ORF Clone, Human

B Raf Background Information

BRAF gene encodes a protein belonging to the raf/mil family of serine/threonine protein kinases. BRAFprotein plays a role in regulating the MAP kinase/ERKs signaling pathway, which affects cell division, differentiation, and secretion. Mutations in BRAF gene are associated with cardiofaciocutaneous syndrome, a disease characterized by heart defects, mental retardation and a distinctive facial appearance. Mutations in BRAF gene have also been associated with various cancers, including non-Hodgkin lymphoma, colorectal cancer, malignant melanoma, thyroid carcinoma, non-small cell lung carcinoma, and adenocarcinoma of lung. A pseudogene, which is located on chromosome X, has been identified for this gene.
Full Name
B-Raf proto-oncogene, serine/threonine kinase
References
  • Weston-Bell NJ, Tapper W, Gibson J, et al. Exome Sequencing in Classic Hairy Cell Leukaemia Reveals Widespread Variation in Acquired Somatic Mutations between Individual Tumours Apart from the Signature BRAF V(600)E Lesion. Richards KL, ed. PLoS ONE. 2016;11(2):e0149162. doi:10.1371/journal.pone.0149162.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait